EMAIL THIS PAGE TO A FRIEND

GAPT

GRB2-binding adaptor protein, transmembrane

122 Gene Product Result for
Synonyms: C5orf29
UniProtKB ID: Q8N292
Gene ID:
Mouse(238875) Grb2-binding adaptor, transmembrane
Rat(686075) Grb2-binding adaptor protein, transmembrane
cow(784765) GRB2-binding adaptor protein, transmembrane
domestic cat(101092333) GRB2-binding adaptor protein, transmembrane
dog(100683936) GRB2-binding adaptor protein, transmembrane
naked mole-rat(101698852) GRB2-binding adaptor protein, transmembrane
domestic guinea pig(100721525) GRB2-binding adaptor protein, transmembrane
sheep(101110362) GRB2-binding adaptor protein, transmembrane
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152687 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131161 MISSION® esiRNA esiRNA human GAPT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152687 Rosetta Predictions human pricing
NM_001109491 Rosetta Predictions rat pricing
NM_177713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019372 predicted 597
2 SASI_Hs01_00019373 predicted 483
3 SASI_Hs01_00019374 predicted 504
4 SASI_Hs01_00019375 predicted 491
5 SASI_Hs01_00019376 predicted 407
6 SASI_Hs01_00019377 predicted 409
7 SASI_Hs01_00019378 predicted 653
8 SASI_Hs01_00019379 predicted 604
9 SASI_Hs01_00019380 predicted 584
10 SASI_Hs01_00019381 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248919 predicted 1023
2 SASI_Rn02_00248920 predicted 979
3 SASI_Rn02_00248921 predicted 540
4 SASI_Rn02_00248922 predicted 836
5 SASI_Rn02_00248923 predicted 629
6 SASI_Rn02_00248924 predicted 877
7 SASI_Rn02_00248925 predicted 1031
8 SASI_Rn02_00248926 predicted 688
9 SASI_Rn02_00248927 predicted 679
10 SASI_Rn02_00248928 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348059 predicted 777
2 SASI_Mm01_00107446 predicted 798
3 SASI_Mm01_00107447 predicted 648
4 SASI_Mm01_00107448 predicted 900
5 SASI_Mm02_00348060 predicted 858
6 SASI_Mm01_00107449 predicted 750
7 SASI_Mm01_00107450 predicted 659
8 SASI_Mm01_00107452 predicted 903
9 SASI_Mm01_00107453 predicted 665
10 SASI_Mm01_00107454 predicted 584
11 SASI_Mm01_00107451 predicted 807
12 SASI_Mm01_00107455 predicted 737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152687
GAPT MISSION shRNA Bacterial Glycerol Stock
GRB2-binding adaptor protein, transmembrane
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152687.2-777s21c1
Sequence:CCGGAGACATCTTCTGACTATTATACTCGAGTATAATAGTCAGAAGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152687.2-826s21c1
Sequence:CCGGTCCTCAAGATGAAGATATATACTCGAGTATATATCTTCATCTTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152687.1-610s1c1
Sequence:CCGGGAAATCTCAGTTGAAACCCAACTCGAGTTGGGTTTCAACTGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152687.1-1463s1c1
Sequence:CCGGGCACCAGACTAAATCTGTATTCTCGAGAATACAGATTTAGTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152687.1-823s1c1
Sequence:CCGGGAAGTTCCTCAAGATGAAGATCTCGAGATCTTCATCTTGAGGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152687.1-514s1c1
Sequence:CCGGCGATTTACCTTACCGAGGTTTCTCGAGAAACCTCGGTAAGGTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152687.1-756s1c1
Sequence:CCGGCGAGGAGCATATCTATGGAAACTCGAGTTTCCATAGATATGCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152687.1-747s1c1
Sequence:CCGGGTCTAATTTCGAGGAGCATATCTCGAGATATGCTCCTCGAAATTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152687.1-817s1c1
Sequence:CCGGCCTTCTGAAGTTCCTCAAGATCTCGAGATCTTGAGGAACTTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152687
GAPT MISSION shRNA shRNA Plasmid DNA
GRB2-binding adaptor protein, transmembrane
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152687.2-777s21c1
Sequence:CCGGAGACATCTTCTGACTATTATACTCGAGTATAATAGTCAGAAGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152687.2-826s21c1
Sequence:CCGGTCCTCAAGATGAAGATATATACTCGAGTATATATCTTCATCTTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152687.1-610s1c1
Sequence:CCGGGAAATCTCAGTTGAAACCCAACTCGAGTTGGGTTTCAACTGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152687.1-1463s1c1
Sequence:CCGGGCACCAGACTAAATCTGTATTCTCGAGAATACAGATTTAGTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152687.1-823s1c1
Sequence:CCGGGAAGTTCCTCAAGATGAAGATCTCGAGATCTTCATCTTGAGGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152687.1-514s1c1
Sequence:CCGGCGATTTACCTTACCGAGGTTTCTCGAGAAACCTCGGTAAGGTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152687.1-756s1c1
Sequence:CCGGCGAGGAGCATATCTATGGAAACTCGAGTTTCCATAGATATGCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152687.1-747s1c1
Sequence:CCGGGTCTAATTTCGAGGAGCATATCTCGAGATATGCTCCTCGAAATTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152687.1-817s1c1
Sequence:CCGGCCTTCTGAAGTTCCTCAAGATCTCGAGATCTTGAGGAACTTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152687
GAPT MISSION shRNA Lentiviral Transduction Particles
GRB2-binding adaptor protein, transmembrane
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152687.2-777s21c1
Sequence:CCGGAGACATCTTCTGACTATTATACTCGAGTATAATAGTCAGAAGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152687.2-826s21c1
Sequence:CCGGTCCTCAAGATGAAGATATATACTCGAGTATATATCTTCATCTTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152687.1-610s1c1
Sequence:CCGGGAAATCTCAGTTGAAACCCAACTCGAGTTGGGTTTCAACTGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152687.1-1463s1c1
Sequence:CCGGGCACCAGACTAAATCTGTATTCTCGAGAATACAGATTTAGTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152687.1-823s1c1
Sequence:CCGGGAAGTTCCTCAAGATGAAGATCTCGAGATCTTCATCTTGAGGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152687.1-514s1c1
Sequence:CCGGCGATTTACCTTACCGAGGTTTCTCGAGAAACCTCGGTAAGGTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152687.1-756s1c1
Sequence:CCGGCGAGGAGCATATCTATGGAAACTCGAGTTTCCATAGATATGCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152687.1-747s1c1
Sequence:CCGGGTCTAATTTCGAGGAGCATATCTCGAGATATGCTCCTCGAAATTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152687.1-817s1c1
Sequence:CCGGCCTTCTGAAGTTCCTCAAGATCTCGAGATCTTGAGGAACTTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177713
GAPT MISSION shRNA Bacterial Glycerol Stock
GRB2-binding adaptor protein, transmembrane
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1470s21c1
Sequence:CCGGTCACTTCATTAATCTGCTAAACTCGAGTTTAGCAGATTAATGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1862s21c1
Sequence:CCGGACTAATGTAATACGAGGATTCCTCGAGGAATCCTCGTATTACATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1837s21c1
Sequence:CCGGATGAAGGTTTGCTGTGCATTTCTCGAGAAATGCACAGCAAACCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1725s21c1
Sequence:CCGGCAAGCCTGCCTCAGGTCATTTCTCGAGAAATGACCTGAGGCAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1744s21c1
Sequence:CCGGTTCTTCCAGCCTCCCTCATTTCTCGAGAAATGAGGGAGGCTGGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177713.2-741s1c1
Sequence:CCGGCGTGATTAGCCCAAGCATGAACTCGAGTTCATGCTTGGGCTAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177713.2-674s1c1
Sequence:CCGGCGAAGTTTATGCAAAGGAGAACTCGAGTTCTCCTTTGCATAAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177713.2-1385s1c1
Sequence:CCGGCCACATCTCTAGTCTGGTCTTCTCGAGAAGACCAGACTAGAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177713
GAPT MISSION shRNA shRNA Plasmid DNA
GRB2-binding adaptor protein, transmembrane
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1470s21c1
Sequence:CCGGTCACTTCATTAATCTGCTAAACTCGAGTTTAGCAGATTAATGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1862s21c1
Sequence:CCGGACTAATGTAATACGAGGATTCCTCGAGGAATCCTCGTATTACATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1837s21c1
Sequence:CCGGATGAAGGTTTGCTGTGCATTTCTCGAGAAATGCACAGCAAACCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1725s21c1
Sequence:CCGGCAAGCCTGCCTCAGGTCATTTCTCGAGAAATGACCTGAGGCAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1744s21c1
Sequence:CCGGTTCTTCCAGCCTCCCTCATTTCTCGAGAAATGAGGGAGGCTGGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177713.2-741s1c1
Sequence:CCGGCGTGATTAGCCCAAGCATGAACTCGAGTTCATGCTTGGGCTAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177713.2-674s1c1
Sequence:CCGGCGAAGTTTATGCAAAGGAGAACTCGAGTTCTCCTTTGCATAAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177713.2-1385s1c1
Sequence:CCGGCCACATCTCTAGTCTGGTCTTCTCGAGAAGACCAGACTAGAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177713
GAPT MISSION shRNA Lentiviral Transduction Particles
GRB2-binding adaptor protein, transmembrane
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1470s21c1
Sequence:CCGGTCACTTCATTAATCTGCTAAACTCGAGTTTAGCAGATTAATGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1862s21c1
Sequence:CCGGACTAATGTAATACGAGGATTCCTCGAGGAATCCTCGTATTACATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1837s21c1
Sequence:CCGGATGAAGGTTTGCTGTGCATTTCTCGAGAAATGCACAGCAAACCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1725s21c1
Sequence:CCGGCAAGCCTGCCTCAGGTCATTTCTCGAGAAATGACCTGAGGCAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177713.3-1744s21c1
Sequence:CCGGTTCTTCCAGCCTCCCTCATTTCTCGAGAAATGAGGGAGGCTGGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177713.2-741s1c1
Sequence:CCGGCGTGATTAGCCCAAGCATGAACTCGAGTTCATGCTTGGGCTAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177713.2-674s1c1
Sequence:CCGGCGAAGTTTATGCAAAGGAGAACTCGAGTTCTCCTTTGCATAAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177713.2-1385s1c1
Sequence:CCGGCCACATCTCTAGTCTGGTCTTCTCGAGAAGACCAGACTAGAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks