EMAIL THIS PAGE TO A FRIEND

GAPVD1

GTPase activating protein and VPS9 domains 1

192 Gene Product Result for
Synonyms: GAPEX5 RAP6
Gene ID:
Mouse(66691) GTPase activating protein and VPS9 domains 1
Rat(311880) GTPase activating protein and VPS9 domains 1
sheep(101105988) GTPase activating protein and VPS9 domains 1
domestic guinea pig(100730826) GTPase activating protein and VPS9 domains 1
naked mole-rat(101708307) GTPase activating protein and VPS9 domains 1
Zebrafish(436693) GTPase activating protein and VPS9 domains 1
cow(539646) GTPase activating protein and VPS9 domains 1
Horse(100070862) GTPase activating protein and VPS9 domains 1
domestic cat(101084144) GTPase activating protein and VPS9 domains 1
dog(480725) GTPase activating protein and VPS9 domains 1
chicken(417095) GTPase activating protein and VPS9 domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_044196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_044196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_044196 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015635 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015635 Rosetta Predictions human pricing
XM_001078902 Rosetta Predictions rat pricing
XM_231161 Rosetta Predictions rat pricing
NM_025709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033536 predicted 3770
2 SASI_Hs01_00033537 predicted 2014
3 SASI_Hs01_00033538 predicted 439
4 SASI_Hs02_00348232 predicted 3459
5 SASI_Hs01_00033539 predicted 447
6 SASI_Hs01_00033540 predicted 3781
7 SASI_Hs01_00033541 predicted 4496
8 SASI_Hs01_00033542 predicted 1583
9 SASI_Hs01_00033544 predicted 4126
10 SASI_Hs02_00348233 predicted 411
11 SASI_Hs01_00033543 predicted 2311
12 SASI_Hs01_00033545 predicted 3708
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362400 predicted 2371
2 SASI_Rn02_00362401 predicted 1811
3 SASI_Rn02_00362402 predicted 1281
4 SASI_Rn02_00362403 predicted 3971
5 SASI_Rn02_00362404 predicted 2411
6 SASI_Rn02_00362405 predicted 4080
7 SASI_Rn02_00362406 predicted 2403
8 SASI_Rn02_00362407 predicted 863
9 SASI_Rn02_00362408 predicted 1999
10 SASI_Rn02_00362409 predicted 2837
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386694 predicted 1813
2 SASI_Rn02_00386695 predicted 4589
3 SASI_Rn02_00386696 predicted 1283
4 SASI_Rn02_00386697 predicted 3974
5 SASI_Rn02_00386698 predicted 877
6 SASI_Rn02_00386699 predicted 2415
7 SASI_Rn02_00386700 predicted 4082
8 SASI_Rn02_00386701 predicted 859
9 SASI_Rn02_00386702 predicted 2835
10 SASI_Rn02_00386703 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198903 predicted 1815
2 SASI_Mm01_00198904 predicted 2380
3 SASI_Mm01_00198905 predicted 731
4 SASI_Mm02_00328888 predicted 1172
5 SASI_Mm01_00198906 predicted 3982
6 SASI_Mm01_00198908 predicted 1992
7 SASI_Mm01_00198910 predicted 1999
8 SASI_Mm01_00198911 predicted 2901
9 SASI_Mm01_00198912 predicted 871
10 SASI_Mm02_00328889 predicted 2837
11 SASI_Mm01_00198907 predicted 4951
12 SASI_Mm01_00198909 predicted 726
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025709
GAPVD1 MISSION shRNA Bacterial Glycerol Stock
GTPase activating protein and VPS9 domains 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025709.2-4959s1c1
Sequence:CCGGGCAGCTTCTTTGAAAGCTGAACTCGAGTTCAGCTTTCAAAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025709.2-4028s1c1
Sequence:CCGGGCTTTGACAATAGGACTTGTACTCGAGTACAAGTCCTATTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025709.2-1411s1c1
Sequence:CCGGCCACATAGTTTGAGGTGGATTCTCGAGAATCCACCTCAAACTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025709.2-4090s1c1
Sequence:CCGGGCTCCGTATATTGCTTATCTTCTCGAGAAGATAAGCAATATACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025709.2-2373s1c1
Sequence:CCGGGCAAGCTACAACACAAGATAACTCGAGTTATCTTGTGTTGTAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025709.2-2813s21c1
Sequence:CCGGTCAGTGTTGTGTCCGGTATAACTCGAGTTATACCGGACACAACACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025709.2-1564s21c1
Sequence:CCGGATATCTGATGCTCCTATTAATCTCGAGATTAATAGGAGCATCAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025709.2-2563s21c1
Sequence:CCGGGAGAACGTGTTAGGTAGTTTGCTCGAGCAAACTACCTAACACGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025709.2-724s21c1
Sequence:CCGGGCAAAGCAACAGAGGATTAATCTCGAGATTAATCCTCTGTTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025709
GAPVD1 MISSION shRNA shRNA Plasmid DNA
GTPase activating protein and VPS9 domains 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025709.2-4959s1c1
Sequence:CCGGGCAGCTTCTTTGAAAGCTGAACTCGAGTTCAGCTTTCAAAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025709.2-4028s1c1
Sequence:CCGGGCTTTGACAATAGGACTTGTACTCGAGTACAAGTCCTATTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025709.2-1411s1c1
Sequence:CCGGCCACATAGTTTGAGGTGGATTCTCGAGAATCCACCTCAAACTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025709.2-4090s1c1
Sequence:CCGGGCTCCGTATATTGCTTATCTTCTCGAGAAGATAAGCAATATACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025709.2-2373s1c1
Sequence:CCGGGCAAGCTACAACACAAGATAACTCGAGTTATCTTGTGTTGTAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025709.2-2813s21c1
Sequence:CCGGTCAGTGTTGTGTCCGGTATAACTCGAGTTATACCGGACACAACACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025709.2-1564s21c1
Sequence:CCGGATATCTGATGCTCCTATTAATCTCGAGATTAATAGGAGCATCAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025709.2-2563s21c1
Sequence:CCGGGAGAACGTGTTAGGTAGTTTGCTCGAGCAAACTACCTAACACGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025709.2-724s21c1
Sequence:CCGGGCAAAGCAACAGAGGATTAATCTCGAGATTAATCCTCTGTTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025709
GAPVD1 MISSION shRNA Lentiviral Transduction Particles
GTPase activating protein and VPS9 domains 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025709.2-4959s1c1
Sequence:CCGGGCAGCTTCTTTGAAAGCTGAACTCGAGTTCAGCTTTCAAAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025709.2-4028s1c1
Sequence:CCGGGCTTTGACAATAGGACTTGTACTCGAGTACAAGTCCTATTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025709.2-1411s1c1
Sequence:CCGGCCACATAGTTTGAGGTGGATTCTCGAGAATCCACCTCAAACTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025709.2-4090s1c1
Sequence:CCGGGCTCCGTATATTGCTTATCTTCTCGAGAAGATAAGCAATATACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025709.2-2373s1c1
Sequence:CCGGGCAAGCTACAACACAAGATAACTCGAGTTATCTTGTGTTGTAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025709.2-2813s21c1
Sequence:CCGGTCAGTGTTGTGTCCGGTATAACTCGAGTTATACCGGACACAACACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025709.2-1564s21c1
Sequence:CCGGATATCTGATGCTCCTATTAATCTCGAGATTAATAGGAGCATCAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025709.2-2563s21c1
Sequence:CCGGGAGAACGTGTTAGGTAGTTTGCTCGAGCAAACTACCTAACACGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025709.2-724s21c1
Sequence:CCGGGCAAAGCAACAGAGGATTAATCTCGAGATTAATCCTCTGTTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_044196
GAPVD1 MISSION shRNA Bacterial Glycerol Stock
GTPase activating protein and VPS9 domains 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_044196.7-6148s1c1
Sequence:CCGGCCCTTGTTGTTGGGAGCATTTCTCGAGAAATGCTCCCAACAACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_044196.7-931s1c1
Sequence:CCGGGCCACTTTACATGAGCCAATTCTCGAGAATTGGCTCATGTAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_044196.7-4233s1c1
Sequence:CCGGGCAGTTTCTTTATGGTGCAATCTCGAGATTGCACCATAAAGAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_044196.7-2193s1c1
Sequence:CCGGGCAAGCTACAACACAGGATAACTCGAGTTATCCTGTGTTGTAGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_044196.7-3695s1c1
Sequence:CCGGCGCAGGATTCAGCTTTCTCTTCTCGAGAAGAGAAAGCTGAATCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_044196
GAPVD1 MISSION shRNA shRNA Plasmid DNA
GTPase activating protein and VPS9 domains 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_044196.7-6148s1c1
Sequence:CCGGCCCTTGTTGTTGGGAGCATTTCTCGAGAAATGCTCCCAACAACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_044196.7-931s1c1
Sequence:CCGGGCCACTTTACATGAGCCAATTCTCGAGAATTGGCTCATGTAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_044196.7-4233s1c1
Sequence:CCGGGCAGTTTCTTTATGGTGCAATCTCGAGATTGCACCATAAAGAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_044196.7-2193s1c1
Sequence:CCGGGCAAGCTACAACACAGGATAACTCGAGTTATCCTGTGTTGTAGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_044196.7-3695s1c1
Sequence:CCGGCGCAGGATTCAGCTTTCTCTTCTCGAGAAGAGAAAGCTGAATCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_044196
GAPVD1 MISSION shRNA Lentiviral Transduction Particles
GTPase activating protein and VPS9 domains 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_044196.7-6148s1c1
Sequence:CCGGCCCTTGTTGTTGGGAGCATTTCTCGAGAAATGCTCCCAACAACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_044196.7-931s1c1
Sequence:CCGGGCCACTTTACATGAGCCAATTCTCGAGAATTGGCTCATGTAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_044196.7-4233s1c1
Sequence:CCGGGCAGTTTCTTTATGGTGCAATCTCGAGATTGCACCATAAAGAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_044196.7-2193s1c1
Sequence:CCGGGCAAGCTACAACACAGGATAACTCGAGTTATCCTGTGTTGTAGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_044196.7-3695s1c1
Sequence:CCGGCGCAGGATTCAGCTTTCTCTTCTCGAGAAGAGAAAGCTGAATCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015635
GAPVD1 MISSION shRNA Bacterial Glycerol Stock
GTPase activating protein and VPS9 domains 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000419221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015635.2-2144s21c1
Sequence:CCGGAGTGACTTTGACCCTAATATTCTCGAGAATATTAGGGTCAAAGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015635.2-2475s21c1
Sequence:CCGGGTGCAACCTCTGAGGATATTCCTCGAGGAATATCCTCAGAGGTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015635
GAPVD1 MISSION shRNA shRNA Plasmid DNA
GTPase activating protein and VPS9 domains 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000419221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015635.2-2144s21c1
Sequence:CCGGAGTGACTTTGACCCTAATATTCTCGAGAATATTAGGGTCAAAGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015635.2-2475s21c1
Sequence:CCGGGTGCAACCTCTGAGGATATTCCTCGAGGAATATCCTCAGAGGTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015635
GAPVD1 MISSION shRNA Lentiviral Transduction Particles
GTPase activating protein and VPS9 domains 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000419221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015635.2-2144s21c1
Sequence:CCGGAGTGACTTTGACCCTAATATTCTCGAGAATATTAGGGTCAAAGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015635.2-2475s21c1
Sequence:CCGGGTGCAACCTCTGAGGATATTCCTCGAGGAATATCCTCAGAGGTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks