EMAIL THIS PAGE TO A FRIEND

GAR1

GAR1 ribonucleoprotein

Synonyms: NOLA1
UniProtKB ID: Q9NY12, Q5MJQ2
Gene ID:
Human(54433) Summary: This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA2 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. These four H/ACA snoRNP proteins are also components of the telomerase complex. The encoded protein of this gene contains two glycine- and arginine-rich domains and is related to Saccharomyces cerevisiae Gar1p. Two splice variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(68147) GAR1 ribonucleoprotein homolog (yeast)
Rat(499709) GAR1 ribonucleoprotein
Zebrafish(393950) GAR1 ribonucleoprotein homolog (yeast)
dog(610515) GAR1 ribonucleoprotein homolog (yeast)
cow(515057) GAR1 ribonucleoprotein homolog (yeast)
domestic cat(101083587) GAR1 ribonucleoprotein homolog (yeast)
chicken(422697) GAR1 ribonucleoprotein homolog (yeast)
naked mole-rat(101705509) GAR1 ribonucleoprotein homolog (yeast)
domestic guinea pig(100714195) GAR1 ribonucleoprotein homolog (yeast)
sheep(101119047) GAR1 ribonucleoprotein homolog (yeast)
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018983 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018983 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018983 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119761 MISSION® esiRNA esiRNA human GAR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018983 Rosetta Predictions human pricing
NM_032993 Rosetta Predictions human pricing
NM_001024306 Rosetta Predictions rat pricing
NM_026578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033622 predicted 505
2 SASI_Hs01_00033623 predicted 502
3 SASI_Hs01_00033624 predicted 486
4 SASI_Hs01_00033625 predicted 538
5 SASI_Hs01_00033626 predicted 537
6 SASI_Hs01_00033627 predicted 483
7 SASI_Hs01_00033628 predicted 547
8 SASI_Hs01_00033629 predicted 502
9 SASI_Hs01_00033630 predicted 989
10 SASI_Hs01_00033631 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028633 predicted 253
2 SASI_Hs01_00028634 predicted 247
3 SASI_Hs01_00028635 predicted 229
4 SASI_Hs01_00028636 predicted 275
5 SASI_Hs01_00028637 predicted 276
6 SASI_Hs01_00028638 predicted 225
7 SASI_Hs01_00028639 predicted 285
8 SASI_Hs01_00028640 predicted 240
9 SASI_Hs01_00028641 predicted 737
10 SASI_Hs01_00028642 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071458 predicted 1130
2 SASI_Rn01_00071459 predicted 1256
3 SASI_Rn01_00071460 predicted 1299
4 SASI_Rn01_00071461 predicted 1029
5 SASI_Rn01_00071462 predicted 477
6 SASI_Rn01_00071463 predicted 510
7 SASI_Rn01_00071464 predicted 1242
8 SASI_Rn01_00071465 predicted 473
9 SASI_Rn01_00071466 predicted 558
10 SASI_Rn02_00202509 predicted 605
11 SASI_Rn01_00071467 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043848 predicted 476
2 SASI_Mm01_00043851 predicted 405
3 SASI_Mm01_00043852 predicted 329
4 SASI_Mm01_00043853 predicted 287
5 SASI_Mm02_00330538 predicted 243
6 SASI_Mm01_00043856 predicted 497
7 SASI_Mm02_00330539 predicted 319
8 SASI_Mm02_00330540 predicted 419
9 SASI_Mm01_00043857 predicted 525
10 SASI_Mm02_00330541 predicted 789
11 SASI_Mm01_00043849 predicted 856
12 SASI_Mm01_00043850 predicted 425
13 SASI_Mm01_00043854 predicted 260
14 SASI_Mm01_00043855 predicted 899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018983
VALIDATED
GAR1 MISSION shRNA Bacterial Glycerol Stock
GAR1 ribonucleoprotein
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-649s21c1
Sequence:CCGGTGAAATATTTGGACAACTCAGCTCGAGCTGAGTTGTCCAAATATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018983.3-983s21c1
Sequence:CCGGACCAGTTGACTTCTGCATTAACTCGAGTTAATGCAGAAGTCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-942s21c1
Sequence:CCGGTCAGAGGGAGAGGACATTAAGCTCGAGCTTAATGTCCTCTCCCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-506s21c1
Sequence:CCGGCCAGAACGTGTAGTCTTATTACTCGAGTAATAAGACTACACGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-544s21c1
Sequence:CCGGCTGTGAAGATGACATAGTTTGCTCGAGCAAACTATGTCATCTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-703s21c1
Sequence:CCGGCATGAAGGCTTCATCCTTTAACTCGAGTTAAAGGATGAAGCCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-681s21c1
Sequence:CCGGTTTCAGTTAAGTTGTCAGAAACTCGAGTTTCTGACAACTTAACTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018983.2-1112s1c1
Sequence:CCGGGTGCAACGGAATAGTGAATTTCTCGAGAAATTCACTATTCCGTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018983.2-507s1c1
Sequence:CCGGCCAGAACGTGTAGTCTTATTACTCGAGTAATAAGACTACACGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018983.2-1054s1c1
Sequence:CCGGGTCTTGAAGATCTTGGTCATTCTCGAGAATGACCAAGATCTTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018983.2-544s1c1
Sequence:CCGGCCTGTGAAGATGACATAGTTTCTCGAGAAACTATGTCATCTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-1006s1c1
Sequence:CCGGCTGCATGATCTGTTTCTACTACTCGAGTAGTAGAAACAGATCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-593s1c1
Sequence:CCGGGCCTTATTTCAATGCTCCTGTCTCGAGACAGGAGCATTGAAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-504s1c1
Sequence:CCGGCCTCCAGAACGTGTAGTCTTACTCGAGTAAGACTACACGTTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-1017s1c1
Sequence:CCGGGTTTCTACTATGGATTGGAAACTCGAGTTTCCAATCCATAGTAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-1012s1c1
Sequence:CCGGGATCTGTTTCTACTATGGATTCTCGAGAATCCATAGTAGAAACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018983
VALIDATED
GAR1 MISSION shRNA shRNA Plasmid DNA
GAR1 ribonucleoprotein
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-649s21c1
Sequence:CCGGTGAAATATTTGGACAACTCAGCTCGAGCTGAGTTGTCCAAATATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018983.3-983s21c1
Sequence:CCGGACCAGTTGACTTCTGCATTAACTCGAGTTAATGCAGAAGTCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-942s21c1
Sequence:CCGGTCAGAGGGAGAGGACATTAAGCTCGAGCTTAATGTCCTCTCCCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-506s21c1
Sequence:CCGGCCAGAACGTGTAGTCTTATTACTCGAGTAATAAGACTACACGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-544s21c1
Sequence:CCGGCTGTGAAGATGACATAGTTTGCTCGAGCAAACTATGTCATCTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-703s21c1
Sequence:CCGGCATGAAGGCTTCATCCTTTAACTCGAGTTAAAGGATGAAGCCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-681s21c1
Sequence:CCGGTTTCAGTTAAGTTGTCAGAAACTCGAGTTTCTGACAACTTAACTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018983.2-1112s1c1
Sequence:CCGGGTGCAACGGAATAGTGAATTTCTCGAGAAATTCACTATTCCGTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018983.2-507s1c1
Sequence:CCGGCCAGAACGTGTAGTCTTATTACTCGAGTAATAAGACTACACGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018983.2-1054s1c1
Sequence:CCGGGTCTTGAAGATCTTGGTCATTCTCGAGAATGACCAAGATCTTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018983.2-544s1c1
Sequence:CCGGCCTGTGAAGATGACATAGTTTCTCGAGAAACTATGTCATCTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-1006s1c1
Sequence:CCGGCTGCATGATCTGTTTCTACTACTCGAGTAGTAGAAACAGATCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-593s1c1
Sequence:CCGGGCCTTATTTCAATGCTCCTGTCTCGAGACAGGAGCATTGAAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-504s1c1
Sequence:CCGGCCTCCAGAACGTGTAGTCTTACTCGAGTAAGACTACACGTTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-1017s1c1
Sequence:CCGGGTTTCTACTATGGATTGGAAACTCGAGTTTCCAATCCATAGTAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-1012s1c1
Sequence:CCGGGATCTGTTTCTACTATGGATTCTCGAGAATCCATAGTAGAAACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018983
VALIDATED
GAR1 MISSION shRNA Lentiviral Transduction Particles
GAR1 ribonucleoprotein
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-649s21c1
Sequence:CCGGTGAAATATTTGGACAACTCAGCTCGAGCTGAGTTGTCCAAATATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018983.3-983s21c1
Sequence:CCGGACCAGTTGACTTCTGCATTAACTCGAGTTAATGCAGAAGTCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-942s21c1
Sequence:CCGGTCAGAGGGAGAGGACATTAAGCTCGAGCTTAATGTCCTCTCCCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-506s21c1
Sequence:CCGGCCAGAACGTGTAGTCTTATTACTCGAGTAATAAGACTACACGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-544s21c1
Sequence:CCGGCTGTGAAGATGACATAGTTTGCTCGAGCAAACTATGTCATCTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-703s21c1
Sequence:CCGGCATGAAGGCTTCATCCTTTAACTCGAGTTAAAGGATGAAGCCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018983.3-681s21c1
Sequence:CCGGTTTCAGTTAAGTTGTCAGAAACTCGAGTTTCTGACAACTTAACTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018983.2-1112s1c1
Sequence:CCGGGTGCAACGGAATAGTGAATTTCTCGAGAAATTCACTATTCCGTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018983.2-507s1c1
Sequence:CCGGCCAGAACGTGTAGTCTTATTACTCGAGTAATAAGACTACACGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018983.2-1054s1c1
Sequence:CCGGGTCTTGAAGATCTTGGTCATTCTCGAGAATGACCAAGATCTTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018983.2-544s1c1
Sequence:CCGGCCTGTGAAGATGACATAGTTTCTCGAGAAACTATGTCATCTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-1006s1c1
Sequence:CCGGCTGCATGATCTGTTTCTACTACTCGAGTAGTAGAAACAGATCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-593s1c1
Sequence:CCGGGCCTTATTTCAATGCTCCTGTCTCGAGACAGGAGCATTGAAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-504s1c1
Sequence:CCGGCCTCCAGAACGTGTAGTCTTACTCGAGTAAGACTACACGTTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-1017s1c1
Sequence:CCGGGTTTCTACTATGGATTGGAAACTCGAGTTTCCAATCCATAGTAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018983.2-1012s1c1
Sequence:CCGGGATCTGTTTCTACTATGGATTCTCGAGAATCCATAGTAGAAACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026578
VALIDATED
GAR1 MISSION shRNA Bacterial Glycerol Stock
GAR1 ribonucleoprotein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026578.2-479s21c1
Sequence:CCGGACATGAAGGCATCTTCCTTTACTCGAGTAAAGGAAGATGCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026578.2-325s21c1
Sequence:CCGGGAAGATGACATCGTGTGTAAACTCGAGTTTACACACGATGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026578.2-759s21c1
Sequence:CCGGGCAGACCTGACCACTTGTGTTCTCGAGAACACAAGTGGTCAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026578.2-357s21c1
Sequence:CCGGGGAGAACAAGGTGCCCTACTTCTCGAGAAGTAGGGCACCTTGTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026578.1-760s1c1
Sequence:CCGGGCAGACCTGACCACTTGTGTTCTCGAGAACACAAGTGGTCAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026578.1-290s1c1
Sequence:CCGGCGTGTCGTCTTGTTAGGAGAACTCGAGTTCTCCTAACAAGACGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026578.1-511s1c1
Sequence:CCGGGAAGTTCTATATAGACCCATACTCGAGTATGGGTCTATATAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026578.1-326s1c1
Sequence:CCGGGAAGATGACATCGTGTGTAAACTCGAGTTTACACACGATGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026578.1-413s1c1
Sequence:CCGGGTCGGGAAAGTGGATGAGATACTCGAGTATCTCATCCACTTTCCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026578
VALIDATED
GAR1 MISSION shRNA shRNA Plasmid DNA
GAR1 ribonucleoprotein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026578.2-479s21c1
Sequence:CCGGACATGAAGGCATCTTCCTTTACTCGAGTAAAGGAAGATGCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026578.2-325s21c1
Sequence:CCGGGAAGATGACATCGTGTGTAAACTCGAGTTTACACACGATGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026578.2-759s21c1
Sequence:CCGGGCAGACCTGACCACTTGTGTTCTCGAGAACACAAGTGGTCAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026578.2-357s21c1
Sequence:CCGGGGAGAACAAGGTGCCCTACTTCTCGAGAAGTAGGGCACCTTGTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026578.1-760s1c1
Sequence:CCGGGCAGACCTGACCACTTGTGTTCTCGAGAACACAAGTGGTCAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026578.1-290s1c1
Sequence:CCGGCGTGTCGTCTTGTTAGGAGAACTCGAGTTCTCCTAACAAGACGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026578.1-511s1c1
Sequence:CCGGGAAGTTCTATATAGACCCATACTCGAGTATGGGTCTATATAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026578.1-326s1c1
Sequence:CCGGGAAGATGACATCGTGTGTAAACTCGAGTTTACACACGATGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026578.1-413s1c1
Sequence:CCGGGTCGGGAAAGTGGATGAGATACTCGAGTATCTCATCCACTTTCCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026578
VALIDATED
GAR1 MISSION shRNA Lentiviral Transduction Particles
GAR1 ribonucleoprotein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026578.2-479s21c1
Sequence:CCGGACATGAAGGCATCTTCCTTTACTCGAGTAAAGGAAGATGCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026578.2-325s21c1
Sequence:CCGGGAAGATGACATCGTGTGTAAACTCGAGTTTACACACGATGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026578.2-759s21c1
Sequence:CCGGGCAGACCTGACCACTTGTGTTCTCGAGAACACAAGTGGTCAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026578.2-357s21c1
Sequence:CCGGGGAGAACAAGGTGCCCTACTTCTCGAGAAGTAGGGCACCTTGTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026578.1-760s1c1
Sequence:CCGGGCAGACCTGACCACTTGTGTTCTCGAGAACACAAGTGGTCAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026578.1-290s1c1
Sequence:CCGGCGTGTCGTCTTGTTAGGAGAACTCGAGTTCTCCTAACAAGACGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026578.1-511s1c1
Sequence:CCGGGAAGTTCTATATAGACCCATACTCGAGTATGGGTCTATATAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026578.1-326s1c1
Sequence:CCGGGAAGATGACATCGTGTGTAAACTCGAGTTTACACACGATGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026578.1-413s1c1
Sequence:CCGGGTCGGGAAAGTGGATGAGATACTCGAGTATCTCATCCACTTTCCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks