EMAIL THIS PAGE TO A FRIEND

GAREM

GRB2 associated, regulator of MAPK1

61 Gene Product Result for
Synonyms: C18orf11 FAM59A Gm944
UniProtKB ID: Q9H706, Q0VAG3, Q0VAG4, Q8ND03, Q9BSF5
Gene ID:
Human(64762) Summary: This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(381126) GRB2 associated, regulator of MAPK1
Rat(679154) GRB2 associated, regulator of MAPK1
domestic guinea pig(100733714) GRB2 associated, regulator of MAPK1
naked mole-rat(101721141) GRB2 associated, regulator of MAPK1
Zebrafish(393138) GRB2 associated, regulator of MAPK1
cow(507330) GRB2 associated, regulator of MAPK1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022751 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022751 Rosetta Predictions human pricing
NM_001033445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356007 predicted 2592
2 SASI_Hs01_00226960 predicted 2464
3 SASI_Hs01_00226961 predicted 677
4 SASI_Hs02_00356008 predicted 2569
5 SASI_Hs01_00226962 predicted 335
6 SASI_Hs01_00226963 predicted 1329
7 SASI_Hs01_00226964 predicted 268
8 SASI_Hs01_00226966 predicted 1477
9 SASI_Hs01_00226967 predicted 2510
10 SASI_Hs01_00226968 predicted 823
11 SASI_Hs01_00226959 predicted 1805
12 SASI_Hs01_00226965 predicted 2612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051226 predicted 2690
2 SASI_Mm01_00051228 predicted 736
3 SASI_Mm02_00288767 predicted 1315
4 SASI_Mm01_00051230 predicted 1532
5 SASI_Mm01_00051231 predicted 596
6 SASI_Mm02_00288768 predicted 1071
7 SASI_Mm01_00051232 predicted 608
8 SASI_Mm01_00051233 predicted 846
9 SASI_Mm01_00051234 predicted 641
10 SASI_Mm01_00051235 predicted 1359
11 SASI_Mm01_00051227 predicted 1330
12 SASI_Mm01_00051229 predicted 1336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022751
GAREM MISSION shRNA Bacterial Glycerol Stock
GRB2 associated, regulator of MAPK1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022751.1-1812s1c1
Sequence:CCGGCCTTCTGAAAGCACTCCTGTTCTCGAGAACAGGAGTGCTTTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022751.1-453s1c1
Sequence:CCGGGCTTCAGGTGAATGCAATGAACTCGAGTTCATTGCATTCACCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022751.1-1778s1c1
Sequence:CCGGGCTACACAACATCGTCACTAACTCGAGTTAGTGACGATGTTGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135065    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022751.1-2746s1c1
Sequence:CCGGCTGGGACACAATTTCATGTTTCTCGAGAAACATGAAATTGTGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022751.1-860s1c1
Sequence:CCGGGCACCGCTATAAGTTTGTGAACTCGAGTTCACAAACTTATAGCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022751.1-2893s1c1
Sequence:CCGGGCCTTGTACGTCACTCAACAACTCGAGTTGTTGAGTGACGTACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022751.1-1560s1c1
Sequence:CCGGGCAGCAGTGAAGTCTTCAGATCTCGAGATCTGAAGACTTCACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022751.1-206s21c1
Sequence:CCGGTGACTATCTGCTGATTCATTCCTCGAGGAATGAATCAGCAGATAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022751.1-1055s21c1
Sequence:CCGGGTTCGACATCGATGAGTATTCCTCGAGGAATACTCATCGATGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022751.1-1480s21c1
Sequence:CCGGAGAACAGATGTGATCAGTTTACTCGAGTAAACTGATCACATCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022751
GAREM MISSION shRNA shRNA Plasmid DNA
GRB2 associated, regulator of MAPK1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022751.1-1812s1c1
Sequence:CCGGCCTTCTGAAAGCACTCCTGTTCTCGAGAACAGGAGTGCTTTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022751.1-453s1c1
Sequence:CCGGGCTTCAGGTGAATGCAATGAACTCGAGTTCATTGCATTCACCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022751.1-1778s1c1
Sequence:CCGGGCTACACAACATCGTCACTAACTCGAGTTAGTGACGATGTTGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135065    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022751.1-2746s1c1
Sequence:CCGGCTGGGACACAATTTCATGTTTCTCGAGAAACATGAAATTGTGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022751.1-860s1c1
Sequence:CCGGGCACCGCTATAAGTTTGTGAACTCGAGTTCACAAACTTATAGCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022751.1-2893s1c1
Sequence:CCGGGCCTTGTACGTCACTCAACAACTCGAGTTGTTGAGTGACGTACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022751.1-1560s1c1
Sequence:CCGGGCAGCAGTGAAGTCTTCAGATCTCGAGATCTGAAGACTTCACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022751.1-206s21c1
Sequence:CCGGTGACTATCTGCTGATTCATTCCTCGAGGAATGAATCAGCAGATAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022751.1-1055s21c1
Sequence:CCGGGTTCGACATCGATGAGTATTCCTCGAGGAATACTCATCGATGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022751.1-1480s21c1
Sequence:CCGGAGAACAGATGTGATCAGTTTACTCGAGTAAACTGATCACATCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022751
GAREM MISSION shRNA Lentiviral Transduction Particles
GRB2 associated, regulator of MAPK1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022751.1-1812s1c1
Sequence:CCGGCCTTCTGAAAGCACTCCTGTTCTCGAGAACAGGAGTGCTTTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022751.1-453s1c1
Sequence:CCGGGCTTCAGGTGAATGCAATGAACTCGAGTTCATTGCATTCACCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022751.1-1778s1c1
Sequence:CCGGGCTACACAACATCGTCACTAACTCGAGTTAGTGACGATGTTGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135065    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022751.1-2746s1c1
Sequence:CCGGCTGGGACACAATTTCATGTTTCTCGAGAAACATGAAATTGTGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022751.1-860s1c1
Sequence:CCGGGCACCGCTATAAGTTTGTGAACTCGAGTTCACAAACTTATAGCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022751.1-2893s1c1
Sequence:CCGGGCCTTGTACGTCACTCAACAACTCGAGTTGTTGAGTGACGTACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022751.1-1560s1c1
Sequence:CCGGGCAGCAGTGAAGTCTTCAGATCTCGAGATCTGAAGACTTCACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022751.1-206s21c1
Sequence:CCGGTGACTATCTGCTGATTCATTCCTCGAGGAATGAATCAGCAGATAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022751.1-1055s21c1
Sequence:CCGGGTTCGACATCGATGAGTATTCCTCGAGGAATACTCATCGATGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022751.1-1480s21c1
Sequence:CCGGAGAACAGATGTGATCAGTTTACTCGAGTAAACTGATCACATCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033445
VALIDATED
GAREM MISSION shRNA Bacterial Glycerol Stock
GRB2 associated, regulator of MAPK1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033445.2-647s21c1
Sequence:CCGGTGGAACAAGACCGGGATATAACTCGAGTTATATCCCGGTCTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033445.2-1367s21c1
Sequence:CCGGAGTTTGACATCGATGAGTATTCTCGAGAATACTCATCGATGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033445.2-2652s21c1
Sequence:CCGGCCTCTCGGAGGACCAGTATTTCTCGAGAAATACTGGTCCTCCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033445.2-1461s21c1
Sequence:CCGGCCACAACCATTTACCCAATTCCTCGAGGAATTGGGTAAATGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033445.2-4129s21c1
Sequence:CCGGTGATTCCTAAGATACCAATAACTCGAGTTATTGGTATCTTAGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033445
VALIDATED
GAREM MISSION shRNA shRNA Plasmid DNA
GRB2 associated, regulator of MAPK1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033445.2-647s21c1
Sequence:CCGGTGGAACAAGACCGGGATATAACTCGAGTTATATCCCGGTCTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033445.2-1367s21c1
Sequence:CCGGAGTTTGACATCGATGAGTATTCTCGAGAATACTCATCGATGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033445.2-2652s21c1
Sequence:CCGGCCTCTCGGAGGACCAGTATTTCTCGAGAAATACTGGTCCTCCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033445.2-1461s21c1
Sequence:CCGGCCACAACCATTTACCCAATTCCTCGAGGAATTGGGTAAATGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033445.2-4129s21c1
Sequence:CCGGTGATTCCTAAGATACCAATAACTCGAGTTATTGGTATCTTAGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033445
VALIDATED
GAREM MISSION shRNA Lentiviral Transduction Particles
GRB2 associated, regulator of MAPK1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033445.2-647s21c1
Sequence:CCGGTGGAACAAGACCGGGATATAACTCGAGTTATATCCCGGTCTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033445.2-1367s21c1
Sequence:CCGGAGTTTGACATCGATGAGTATTCTCGAGAATACTCATCGATGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033445.2-2652s21c1
Sequence:CCGGCCTCTCGGAGGACCAGTATTTCTCGAGAAATACTGGTCCTCCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033445.2-1461s21c1
Sequence:CCGGCCACAACCATTTACCCAATTCCTCGAGGAATTGGGTAAATGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033445.2-4129s21c1
Sequence:CCGGTGATTCCTAAGATACCAATAACTCGAGTTATTGGTATCTTAGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks