EMAIL THIS PAGE TO A FRIEND

GAREML

GRB2 associated, regulator of MAPK1-like

97 Gene Product Result for
Synonyms: FAM59B
UniProtKB ID: Q75VX8, B5MC97, B7WNK9, Q8NF27, Q9UIK8
Gene ID:
Mouse(242915) GRB2 associated, regulator of MAPK1-like
Rat(362801) GRB2 associated, regulator of MAPK1-like
Zebrafish(100331995) GRB2 associated, regulator of MAPK1-like
naked mole-rat(101723767) GRB2 associated, regulator of MAPK1-like
domestic guinea pig(100723282) GRB2 associated, regulator of MAPK1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001168241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001168241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001168241 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_097977 Rosetta Predictions human pricing
XR_041887 Rosetta Predictions human pricing
XR_041888 Rosetta Predictions human pricing
XR_041889 Rosetta Predictions human pricing
XM_001069822 Rosetta Predictions rat pricing
XM_343127 Rosetta Predictions rat pricing
XM_144253 Rosetta Predictions mouse pricing
XM_908279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_097977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286656 predicted 1215
2 SASI_Hs01_00286657 predicted 3454
3 SASI_Hs01_00286658 predicted 3049
4 SASI_Hs01_00286659 predicted 2749
5 SASI_Hs01_00286660 predicted 3357
6 SASI_Hs01_00286661 predicted 3293
7 SASI_Hs01_00286662 predicted 3227
8 SASI_Hs01_00286663 predicted 2907
9 SASI_Hs01_00286664 predicted 2845
10 SASI_Hs01_00286665 predicted 2784
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531242 predicted 3288
2 SASI_Hs02_00531243 predicted 3013
3 SASI_Hs02_00531244 predicted 2503
4 SASI_Hs02_00531245 predicted 2785
5 SASI_Hs02_00531246 predicted 2493
6 SASI_Hs02_00531247 predicted 2582
7 SASI_Hs02_00531248 predicted 2360
8 SASI_Hs02_00531249 predicted 2776
9 SASI_Hs02_00531250 predicted 2976
10 SASI_Hs02_00531251 predicted 3179
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531252 predicted 4136
2 SASI_Hs02_00531253 predicted 3864
3 SASI_Hs02_00531254 predicted 1207
4 SASI_Hs02_00531255 predicted 3774
5 SASI_Hs02_00531256 predicted 3048
6 SASI_Hs02_00531257 predicted 3352
7 SASI_Hs02_00531258 predicted 3289
8 SASI_Hs02_00531259 predicted 3215
9 SASI_Hs02_00531260 predicted 1209
10 SASI_Hs02_00531261 predicted 3949
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531262 predicted 4139
2 SASI_Hs02_00531263 predicted 3869
3 SASI_Hs02_00531264 predicted 1208
4 SASI_Hs02_00531265 predicted 3769
5 SASI_Hs02_00531266 predicted 3049
6 SASI_Hs02_00531267 predicted 3347
7 SASI_Hs02_00531268 predicted 3290
8 SASI_Hs02_00531269 predicted 3216
9 SASI_Hs02_00531270 predicted 1205
10 SASI_Hs02_00531271 predicted 3956
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069822 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329434 predicted 644
2 SASI_Rn02_00329435 predicted 509
3 SASI_Rn02_00329436 predicted 522
4 SASI_Rn02_00329437 predicted 2367
5 SASI_Rn02_00329438 predicted 541
6 SASI_Rn02_00329439 predicted 1827
7 SASI_Rn02_00329440 predicted 1633
8 SASI_Rn02_00329441 predicted 1962
9 SASI_Rn02_00329442 predicted 1532
10 SASI_Rn02_00329443 predicted 1954
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395363 predicted 854
2 SASI_Rn02_00395364 predicted 707
3 SASI_Rn02_00395365 predicted 728
4 SASI_Rn02_00395366 predicted 2621
5 SASI_Rn02_00395367 predicted 741
6 SASI_Rn02_00395368 predicted 2218
7 SASI_Rn02_00395369 predicted 585
8 SASI_Rn02_00395370 predicted 2273
9 SASI_Rn02_00395371 predicted 2229
10 SASI_Rn02_00395372 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_144253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244993 predicted 1923
2 SASI_Mm01_00244994 predicted 2323
3 SASI_Mm02_00425228 predicted 418
4 SASI_Mm02_00425229 predicted 458
5 SASI_Mm02_00425230 predicted 2667
6 SASI_Mm02_00425231 predicted 2574
7 SASI_Mm01_00244998 predicted 418
8 SASI_Mm02_00425232 predicted 2585
9 SASI_Mm02_00425233 predicted 2670
10 SASI_Mm02_00425234 predicted 2537
11 SASI_Mm01_00244992 predicted 564
12 SASI_Mm01_00244995 predicted 2681
13 SASI_Mm01_00244996 predicted 231
14 SASI_Mm01_00244997 predicted 1743
15 SASI_Mm01_00244999 predicted 1983
16 SASI_Mm01_00245000 predicted 544
17 SASI_Mm01_00245001 predicted 2625
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433939 predicted 558
2 SASI_Mm02_00433940 predicted 1917
3 SASI_Mm02_00433941 predicted 2328
4 SASI_Mm02_00433942 predicted 2674
5 SASI_Mm02_00433943 predicted 223
6 SASI_Mm02_00433944 predicted 1740
7 SASI_Mm02_00433945 predicted 412
8 SASI_Mm02_00433946 predicted 1970
9 SASI_Mm02_00433947 predicted 544
10 SASI_Mm02_00433948 predicted 2624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001168241
GAREML MISSION shRNA Bacterial Glycerol Stock
GRB2 associated, regulator of MAPK1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-2632s21c1
Sequence:CCGGACGCATCGATGGTAGCATCTTCTCGAGAAGATGCTACCATCGATGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168241.1-3144s21c1
Sequence:CCGGCAAGAAGATGGCTGGTAATTTCTCGAGAAATTACCAGCCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-2498s21c1
Sequence:CCGGACAGGCTTTGGAGTCCGAGATCTCGAGATCTCGGACTCCAAAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-1967s21c1
Sequence:CCGGCCTCTATTCAAGCCCTCACATCTCGAGATGTGAGGGCTTGAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-1992s21c1
Sequence:CCGGAGAAGCGCTTTGCTCCGTTTGCTCGAGCAAACGGAGCAAAGCGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-2572s21c1
Sequence:CCGGCTCTCGCAGTCTGCGTTTCATCTCGAGATGAAACGCAGACTGCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-305s21c1
Sequence:CCGGACAACGGTGACAGCTCATACCCTCGAGGGTATGAGCTGTCACCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-1663s21c1
Sequence:CCGGCAAGCTGCAGCCGGTACATTCCTCGAGGAATGTACCGGCTGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-2604s21c1
Sequence:CCGGAGGATGTGGTGAGCTTCTTTGCTCGAGCAAAGAAGCTCACCACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001168241
GAREML MISSION shRNA shRNA Plasmid DNA
GRB2 associated, regulator of MAPK1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-2632s21c1
Sequence:CCGGACGCATCGATGGTAGCATCTTCTCGAGAAGATGCTACCATCGATGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168241.1-3144s21c1
Sequence:CCGGCAAGAAGATGGCTGGTAATTTCTCGAGAAATTACCAGCCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-2498s21c1
Sequence:CCGGACAGGCTTTGGAGTCCGAGATCTCGAGATCTCGGACTCCAAAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-1967s21c1
Sequence:CCGGCCTCTATTCAAGCCCTCACATCTCGAGATGTGAGGGCTTGAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-1992s21c1
Sequence:CCGGAGAAGCGCTTTGCTCCGTTTGCTCGAGCAAACGGAGCAAAGCGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-2572s21c1
Sequence:CCGGCTCTCGCAGTCTGCGTTTCATCTCGAGATGAAACGCAGACTGCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-305s21c1
Sequence:CCGGACAACGGTGACAGCTCATACCCTCGAGGGTATGAGCTGTCACCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-1663s21c1
Sequence:CCGGCAAGCTGCAGCCGGTACATTCCTCGAGGAATGTACCGGCTGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-2604s21c1
Sequence:CCGGAGGATGTGGTGAGCTTCTTTGCTCGAGCAAAGAAGCTCACCACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001168241
GAREML MISSION shRNA Lentiviral Transduction Particles
GRB2 associated, regulator of MAPK1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-2632s21c1
Sequence:CCGGACGCATCGATGGTAGCATCTTCTCGAGAAGATGCTACCATCGATGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168241.1-3144s21c1
Sequence:CCGGCAAGAAGATGGCTGGTAATTTCTCGAGAAATTACCAGCCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-2498s21c1
Sequence:CCGGACAGGCTTTGGAGTCCGAGATCTCGAGATCTCGGACTCCAAAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-1967s21c1
Sequence:CCGGCCTCTATTCAAGCCCTCACATCTCGAGATGTGAGGGCTTGAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-1992s21c1
Sequence:CCGGAGAAGCGCTTTGCTCCGTTTGCTCGAGCAAACGGAGCAAAGCGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-2572s21c1
Sequence:CCGGCTCTCGCAGTCTGCGTTTCATCTCGAGATGAAACGCAGACTGCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-305s21c1
Sequence:CCGGACAACGGTGACAGCTCATACCCTCGAGGGTATGAGCTGTCACCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-1663s21c1
Sequence:CCGGCAAGCTGCAGCCGGTACATTCCTCGAGGAATGTACCGGCTGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168241.1-2604s21c1
Sequence:CCGGAGGATGTGGTGAGCTTCTTTGCTCGAGCAAAGAAGCTCACCACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks