EMAIL THIS PAGE TO A FRIEND

GARNL3

GTPase activating Rap/RanGAP domain-like 3

Synonyms: bA356B19.1
UniProtKB ID: Q5VVW2, B4DEP7, Q8IYU1, Q8N951, Q8ND89, Q9BQH6
Gene ID:
Mouse(99326) GTPase activating RANGAP domain-like 3
Rat(499783) GTPase activating Rap/RanGAP domain-like 3
sheep(101104385) GTPase activating Rap/RanGAP domain-like 3
Domestic Rabbit(100340536) GTPase activating Rap/RanGAP domain-like 3
domestic guinea pig(100728429) GTPase activating Rap/RanGAP domain-like 3
naked mole-rat(101699700) GTPase activating Rap/RanGAP domain-like 3
Zebrafish(560594) GTPase-activating Rap/Ran-GAP domain-like protein 3-like
chicken(417087) GTPase activating Rap/RanGAP domain-like 3
dog(480718) GTPase activating Rap/RanGAP domain-like 3
domestic cat(101091056) GTPase activating Rap/RanGAP domain-like 3
cow(507761) GTPase activating Rap/RanGAP domain-like 3
Horse(100070564) GTPase activating Rap/RanGAP domain-like 3
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032293 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032293 Rosetta Predictions human pricing
XM_001078585 Rosetta Predictions rat pricing
XM_575116 Rosetta Predictions rat pricing
NM_178888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047235 predicted 1937
2 SASI_Hs01_00047236 predicted 2219
3 SASI_Hs01_00047237 predicted 2021
4 SASI_Hs01_00047238 predicted 1003
5 SASI_Hs01_00047240 predicted 588
6 SASI_Hs01_00047241 predicted 952
7 SASI_Hs01_00047242 predicted 1773
8 SASI_Hs01_00047243 predicted 2559
9 SASI_Hs02_00359628 predicted 413
10 SASI_Hs01_00047244 predicted 774
11 SASI_Hs01_00047239 predicted 2905
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361338 predicted 2067
2 SASI_Rn02_00361339 predicted 1040
3 SASI_Rn02_00361340 predicted 2181
4 SASI_Rn02_00361341 predicted 603
5 SASI_Rn02_00361342 predicted 1737
6 SASI_Rn02_00361343 predicted 2649
7 SASI_Rn02_00361344 predicted 877
8 SASI_Rn02_00361345 predicted 406
9 SASI_Rn02_00361346 predicted 2021
10 SASI_Rn02_00361347 predicted 2982
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179977 predicted 1303
2 SASI_Rn01_00179978 predicted 843
3 SASI_Rn01_00179979 predicted 990
4 SASI_Rn01_00179980 predicted 1719
5 SASI_Rn01_00179981 predicted 1834
6 SASI_Rn01_00179982 predicted 556
7 SASI_Rn01_00179983 predicted 2297
8 SASI_Rn01_00179984 predicted 834
9 SASI_Rn01_00179985 predicted 367
10 SASI_Rn01_00179986 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349479 predicted 3067
2 SASI_Mm01_00191802 predicted 1174
3 SASI_Mm01_00191803 predicted 1498
4 SASI_Mm01_00191804 predicted 455
5 SASI_Mm01_00191806 predicted 2004
6 SASI_Mm01_00191807 predicted 1687
7 SASI_Mm01_00191808 predicted 2596
8 SASI_Mm01_00191809 predicted 360
9 SASI_Mm01_00191811 predicted 2207
10 SASI_Mm02_00349480 predicted 1224
11 SASI_Mm01_00191805 predicted 1815
12 SASI_Mm01_00191810 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178888
GARNL3 MISSION shRNA Bacterial Glycerol Stock
GTPase activating Rap/RanGAP domain-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178888.4-1859s21c1
Sequence:CCGGGTGGTTGCAATTCGCAATAAACTCGAGTTTATTGCGAATTGCAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178888.3-3109s1c1
Sequence:CCGGCCTATTGGCCATCCTTAGTTTCTCGAGAAACTAAGGATGGCCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178888.3-936s1c1
Sequence:CCGGGCGCCACATTGGAAACGATATCTCGAGATATCGTTTCCAATGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178888.3-1612s1c1
Sequence:CCGGCCCGTGTTTGACAGAACTCTACTCGAGTAGAGTTCTGTCAAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178888.3-2161s1c1
Sequence:CCGGGCAGCTATTGATGTTTATGAACTCGAGTTCATAAACATCAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178888
GARNL3 MISSION shRNA shRNA Plasmid DNA
GTPase activating Rap/RanGAP domain-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178888.4-1859s21c1
Sequence:CCGGGTGGTTGCAATTCGCAATAAACTCGAGTTTATTGCGAATTGCAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178888.3-3109s1c1
Sequence:CCGGCCTATTGGCCATCCTTAGTTTCTCGAGAAACTAAGGATGGCCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178888.3-936s1c1
Sequence:CCGGGCGCCACATTGGAAACGATATCTCGAGATATCGTTTCCAATGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178888.3-1612s1c1
Sequence:CCGGCCCGTGTTTGACAGAACTCTACTCGAGTAGAGTTCTGTCAAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178888.3-2161s1c1
Sequence:CCGGGCAGCTATTGATGTTTATGAACTCGAGTTCATAAACATCAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178888
GARNL3 MISSION shRNA Lentiviral Transduction Particles
GTPase activating Rap/RanGAP domain-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178888.4-1859s21c1
Sequence:CCGGGTGGTTGCAATTCGCAATAAACTCGAGTTTATTGCGAATTGCAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178888.3-3109s1c1
Sequence:CCGGCCTATTGGCCATCCTTAGTTTCTCGAGAAACTAAGGATGGCCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178888.3-936s1c1
Sequence:CCGGGCGCCACATTGGAAACGATATCTCGAGATATCGTTTCCAATGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178888.3-1612s1c1
Sequence:CCGGCCCGTGTTTGACAGAACTCTACTCGAGTAGAGTTCTGTCAAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178888.3-2161s1c1
Sequence:CCGGGCAGCTATTGATGTTTATGAACTCGAGTTCATAAACATCAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032293
GARNL3 MISSION shRNA Bacterial Glycerol Stock
GTPase activating Rap/RanGAP domain-like 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-978s1c1
Sequence:CCGGCGCTCCCACTTTACACATATTCTCGAGAATATGTGTAAAGTGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-857s1c1
Sequence:CCGGGCCATATTCCAAAGAGAACAACTCGAGTTGTTCTCTTTGGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-332s1c1
Sequence:CCGGCCGTCAGAACTACATTGGAAACTCGAGTTTCCAATGTAGTTCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-2896s1c1
Sequence:CCGGCCTTGGAAAGTGCTTCTACTTCTCGAGAAGTAGAAGCACTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-2118s1c1
Sequence:CCGGGCAGCTATTGATGTGTACGAACTCGAGTTCGTACACATCAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032293
GARNL3 MISSION shRNA shRNA Plasmid DNA
GTPase activating Rap/RanGAP domain-like 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-978s1c1
Sequence:CCGGCGCTCCCACTTTACACATATTCTCGAGAATATGTGTAAAGTGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-857s1c1
Sequence:CCGGGCCATATTCCAAAGAGAACAACTCGAGTTGTTCTCTTTGGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-332s1c1
Sequence:CCGGCCGTCAGAACTACATTGGAAACTCGAGTTTCCAATGTAGTTCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-2896s1c1
Sequence:CCGGCCTTGGAAAGTGCTTCTACTTCTCGAGAAGTAGAAGCACTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-2118s1c1
Sequence:CCGGGCAGCTATTGATGTGTACGAACTCGAGTTCGTACACATCAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032293
GARNL3 MISSION shRNA Lentiviral Transduction Particles
GTPase activating Rap/RanGAP domain-like 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-978s1c1
Sequence:CCGGCGCTCCCACTTTACACATATTCTCGAGAATATGTGTAAAGTGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-857s1c1
Sequence:CCGGGCCATATTCCAAAGAGAACAACTCGAGTTGTTCTCTTTGGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-332s1c1
Sequence:CCGGCCGTCAGAACTACATTGGAAACTCGAGTTTCCAATGTAGTTCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-2896s1c1
Sequence:CCGGCCTTGGAAAGTGCTTCTACTTCTCGAGAAGTAGAAGCACTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032293.3-2118s1c1
Sequence:CCGGGCAGCTATTGATGTGTACGAACTCGAGTTCGTACACATCAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks