EMAIL THIS PAGE TO A FRIEND

GARS

glycyl-tRNA synthetase

65 Gene Product Result for
Synonyms: CMT2D DSMAV GlyRS HMN5 SMAD1
UniProtKB ID: P41250, B3KQA2, B4DIA0, Q969Y1
Gene ID:
Human(2617) Summary: This gene encodes glycyl-tRNA synthetase, one of the aminoacyl-tRNA synthetases that charge tRNAs with their cognate amino acids. The encoded enzyme is an (alpha)2 dimer which belongs to the class II family of tRNA synthetases. It has been shown to be a target of autoantibodies in the human autoimmune diseases, polymyositis or dermatomyositis. [provided by RefSeq, Jul 2008]
Mouse(353172) glycyl-tRNA synthetase
Rat(297113) glycyl-tRNA synthetase
Zebrafish(337230) glycyl-tRNA synthetase
chicken(428403) glycyl-tRNA synthetase
cow(408010) glycyl-tRNA synthetase
domestic cat(101094998) glycyl-tRNA synthetase
dog(475268) glycyl-tRNA synthetase
naked mole-rat(101723530) glycyl-tRNA synthetase
domestic guinea pig(100723446) glycyl-tRNA synthetase
sheep(101101977) glycyl-tRNA synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002047 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_180678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_180678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_180678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002047 Rosetta Predictions human pricing
XM_001061006 Rosetta Predictions rat pricing
XM_216152 Rosetta Predictions rat pricing
NM_180678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195703 predicted 783
2 SASI_Hs01_00195704 predicted 2092
3 SASI_Hs01_00195705 predicted 1570
4 SASI_Hs01_00195708 predicted 1902
5 SASI_Hs01_00195709 predicted 1535
6 SASI_Hs01_00195711 predicted 1777
7 SASI_Hs02_00333085 predicted 1106
8 SASI_Hs02_00333086 predicted 697
9 SASI_Hs01_00195712 predicted 2272
10 SASI_Hs02_00333087 predicted 2289
11 SASI_Hs01_00195706 predicted 1549
12 SASI_Hs01_00195707 predicted 1874
13 SASI_Hs01_00195710 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298428 predicted 2307
2 SASI_Rn02_00298429 predicted 1630
3 SASI_Rn02_00298430 predicted 2017
4 SASI_Rn02_00298431 predicted 949
5 SASI_Rn02_00298432 predicted 2144
6 SASI_Rn02_00298433 predicted 2175
7 SASI_Rn02_00298434 predicted 1417
8 SASI_Rn02_00298435 predicted 894
9 SASI_Rn02_00298436 predicted 1247
10 SASI_Rn02_00298437 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376470 predicted 2229
2 SASI_Rn02_00376471 predicted 1539
3 SASI_Rn02_00376472 predicted 1937
4 SASI_Rn02_00376473 predicted 866
5 SASI_Rn02_00376474 predicted 2066
6 SASI_Rn02_00376475 predicted 2088
7 SASI_Rn02_00376476 predicted 1335
8 SASI_Rn02_00376477 predicted 815
9 SASI_Rn02_00376478 predicted 1163
10 SASI_Rn02_00376479 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_180678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175265 predicted 1872
2 SASI_Mm01_00175266 predicted 1796
3 SASI_Mm02_00349581 predicted 1202
4 SASI_Mm01_00175267 predicted 344
5 SASI_Mm01_00175268 predicted 1707
6 SASI_Mm01_00175269 predicted 1434
7 SASI_Mm01_00175270 predicted 1050
8 SASI_Mm01_00175271 predicted 1196
9 SASI_Mm01_00175272 predicted 2014
10 SASI_Mm01_00175273 predicted 1004
11 SASI_Mm01_00175274 predicted 986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002047
VALIDATED
GARS MISSION shRNA Bacterial Glycerol Stock
glycyl-tRNA synthetase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002047.1-1539s1c1
Sequence:CCGGGCTGTTGAACAGGGTGTGATTCTCGAGAATCACACCCTGTTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002047.1-1848s1c1
Sequence:CCGGGAACCCAGTAAGGGAGCAATTCTCGAGAATTGCTCCCTTACTGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002047.1-693s1c1
Sequence:CCGGCAGCCCAAAGATGATATTGTACTCGAGTACAATATCATCTTTGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002047.1-2421s1c1
Sequence:CCGGCGTGACTCAATGCGGCAGATACTCGAGTATCTGCCGCATTGAGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002047.1-817s1c1
Sequence:CCGGGCTGTGCTTTGAAGAACAATACTCGAGTATTGTTCTTCAAAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-1849s21c1
Sequence:CCGGGAACCCAGTAAGGGAGCAATTCTCGAGAATTGCTCCCTTACTGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-1540s21c1
Sequence:CCGGGCTGTTGAACAGGGTGTGATTCTCGAGAATCACACCCTGTTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-2422s21c1
Sequence:CCGGCGTGACTCAATGCGGCAGATACTCGAGTATCTGCCGCATTGAGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-818s21c1
Sequence:CCGGGCTGTGCTTTGAAGAACAATACTCGAGTATTGTTCTTCAAAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-694s21c1
Sequence:CCGGCAGCCCAAAGATGATATTGTACTCGAGTACAATATCATCTTTGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002047
VALIDATED
GARS MISSION shRNA shRNA Plasmid DNA
glycyl-tRNA synthetase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002047.1-1539s1c1
Sequence:CCGGGCTGTTGAACAGGGTGTGATTCTCGAGAATCACACCCTGTTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002047.1-1848s1c1
Sequence:CCGGGAACCCAGTAAGGGAGCAATTCTCGAGAATTGCTCCCTTACTGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002047.1-693s1c1
Sequence:CCGGCAGCCCAAAGATGATATTGTACTCGAGTACAATATCATCTTTGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002047.1-2421s1c1
Sequence:CCGGCGTGACTCAATGCGGCAGATACTCGAGTATCTGCCGCATTGAGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002047.1-817s1c1
Sequence:CCGGGCTGTGCTTTGAAGAACAATACTCGAGTATTGTTCTTCAAAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-1849s21c1
Sequence:CCGGGAACCCAGTAAGGGAGCAATTCTCGAGAATTGCTCCCTTACTGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-1540s21c1
Sequence:CCGGGCTGTTGAACAGGGTGTGATTCTCGAGAATCACACCCTGTTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-2422s21c1
Sequence:CCGGCGTGACTCAATGCGGCAGATACTCGAGTATCTGCCGCATTGAGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-818s21c1
Sequence:CCGGGCTGTGCTTTGAAGAACAATACTCGAGTATTGTTCTTCAAAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-694s21c1
Sequence:CCGGCAGCCCAAAGATGATATTGTACTCGAGTACAATATCATCTTTGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002047
VALIDATED
GARS MISSION shRNA Lentiviral Transduction Particles
glycyl-tRNA synthetase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002047.1-1539s1c1
Sequence:CCGGGCTGTTGAACAGGGTGTGATTCTCGAGAATCACACCCTGTTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002047.1-1848s1c1
Sequence:CCGGGAACCCAGTAAGGGAGCAATTCTCGAGAATTGCTCCCTTACTGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002047.1-693s1c1
Sequence:CCGGCAGCCCAAAGATGATATTGTACTCGAGTACAATATCATCTTTGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002047.1-2421s1c1
Sequence:CCGGCGTGACTCAATGCGGCAGATACTCGAGTATCTGCCGCATTGAGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002047.1-817s1c1
Sequence:CCGGGCTGTGCTTTGAAGAACAATACTCGAGTATTGTTCTTCAAAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-1849s21c1
Sequence:CCGGGAACCCAGTAAGGGAGCAATTCTCGAGAATTGCTCCCTTACTGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-1540s21c1
Sequence:CCGGGCTGTTGAACAGGGTGTGATTCTCGAGAATCACACCCTGTTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-2422s21c1
Sequence:CCGGCGTGACTCAATGCGGCAGATACTCGAGTATCTGCCGCATTGAGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-818s21c1
Sequence:CCGGGCTGTGCTTTGAAGAACAATACTCGAGTATTGTTCTTCAAAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002047.2-694s21c1
Sequence:CCGGCAGCCCAAAGATGATATTGTACTCGAGTACAATATCATCTTTGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_180678
VALIDATED
GARS MISSION shRNA Bacterial Glycerol Stock
glycyl-tRNA synthetase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180678.2-2225s1c1
Sequence:CCGGGCTTATGACCATCGTGCTAATCTCGAGATTAGCACGATGGTCATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180678.2-1037s1c1
Sequence:CCGGGCAGAGATTGAGCACTTTGTACTCGAGTACAAAGTGCTCAATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180678.2-368s1c1
Sequence:CCGGGATACGTTGAAGAGGAGGTTTCTCGAGAAACCTCCTCTTCAACGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180678.2-1553s1c1
Sequence:CCGGGCCTGTGATGAGTGCTACATTCTCGAGAATGTAGCACTCATCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180678.2-1998s1c1
Sequence:CCGGGCATCACTATTGACTTTGATACTCGAGTATCAAAGTCAATAGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180678.3-1056s21c1
Sequence:CCGGGCAGAGATTGAGCACTTTGTACTCGAGTACAAAGTGCTCAATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180678.3-387s21c1
Sequence:CCGGGATACGTTGAAGAGGAGGTTTCTCGAGAAACCTCCTCTTCAACGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180678.3-1572s21c1
Sequence:CCGGGCCTGTGATGAGTGCTACATTCTCGAGAATGTAGCACTCATCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180678.3-2017s21c1
Sequence:CCGGGCATCACTATTGACTTTGATACTCGAGTATCAAAGTCAATAGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_180678.3-2244s21c1
Sequence:CCGGGCTTATGACCATCGTGCTAATCTCGAGATTAGCACGATGGTCATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_180678
VALIDATED
GARS MISSION shRNA shRNA Plasmid DNA
glycyl-tRNA synthetase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180678.2-2225s1c1
Sequence:CCGGGCTTATGACCATCGTGCTAATCTCGAGATTAGCACGATGGTCATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180678.2-1037s1c1
Sequence:CCGGGCAGAGATTGAGCACTTTGTACTCGAGTACAAAGTGCTCAATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180678.2-368s1c1
Sequence:CCGGGATACGTTGAAGAGGAGGTTTCTCGAGAAACCTCCTCTTCAACGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180678.2-1553s1c1
Sequence:CCGGGCCTGTGATGAGTGCTACATTCTCGAGAATGTAGCACTCATCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180678.2-1998s1c1
Sequence:CCGGGCATCACTATTGACTTTGATACTCGAGTATCAAAGTCAATAGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180678.3-1056s21c1
Sequence:CCGGGCAGAGATTGAGCACTTTGTACTCGAGTACAAAGTGCTCAATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180678.3-387s21c1
Sequence:CCGGGATACGTTGAAGAGGAGGTTTCTCGAGAAACCTCCTCTTCAACGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180678.3-1572s21c1
Sequence:CCGGGCCTGTGATGAGTGCTACATTCTCGAGAATGTAGCACTCATCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180678.3-2017s21c1
Sequence:CCGGGCATCACTATTGACTTTGATACTCGAGTATCAAAGTCAATAGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_180678.3-2244s21c1
Sequence:CCGGGCTTATGACCATCGTGCTAATCTCGAGATTAGCACGATGGTCATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_180678
VALIDATED
GARS MISSION shRNA Lentiviral Transduction Particles
glycyl-tRNA synthetase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180678.2-2225s1c1
Sequence:CCGGGCTTATGACCATCGTGCTAATCTCGAGATTAGCACGATGGTCATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180678.2-1037s1c1
Sequence:CCGGGCAGAGATTGAGCACTTTGTACTCGAGTACAAAGTGCTCAATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180678.2-368s1c1
Sequence:CCGGGATACGTTGAAGAGGAGGTTTCTCGAGAAACCTCCTCTTCAACGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180678.2-1553s1c1
Sequence:CCGGGCCTGTGATGAGTGCTACATTCTCGAGAATGTAGCACTCATCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180678.2-1998s1c1
Sequence:CCGGGCATCACTATTGACTTTGATACTCGAGTATCAAAGTCAATAGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180678.3-1056s21c1
Sequence:CCGGGCAGAGATTGAGCACTTTGTACTCGAGTACAAAGTGCTCAATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180678.3-387s21c1
Sequence:CCGGGATACGTTGAAGAGGAGGTTTCTCGAGAAACCTCCTCTTCAACGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180678.3-1572s21c1
Sequence:CCGGGCCTGTGATGAGTGCTACATTCTCGAGAATGTAGCACTCATCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180678.3-2017s21c1
Sequence:CCGGGCATCACTATTGACTTTGATACTCGAGTATCAAAGTCAATAGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_180678.3-2244s21c1
Sequence:CCGGGCTTATGACCATCGTGCTAATCTCGAGATTAGCACGATGGTCATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)