EMAIL THIS PAGE TO A FRIEND

GART

phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase

87 Gene Product Result for
Synonyms: AIRS GARS GARTF PAIS PGFT PRGS
Gene ID:
Human(2618) Summary: The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(14450) phosphoribosylglycinamide formyltransferase
Rat(288259) phosphoribosylglycinamide formyltransferase
Zebrafish(58141) phosphoribosylglycinamide formyltransferase
chicken(395315) phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
cow(281183) phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
Horse(100052316) phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
domestic cat(101087772) phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
dog(487740) phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
sheep(101121731) phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
Domestic Rabbit(100328811) phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
domestic guinea pig(100729412) phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
naked mole-rat(101697318) phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000819 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000819 Rosetta Predictions human pricing
NM_175085 Rosetta Predictions human pricing
NM_001011899 Rosetta Predictions rat pricing
XM_001068637 Rosetta Predictions rat pricing
XM_573258 Rosetta Predictions rat pricing
NM_010256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167448 predicted 888
2 SASI_Hs01_00167449 predicted 445
3 SASI_Hs02_00303293 predicted 912
4 SASI_Hs01_00167451 predicted 223
5 SASI_Hs01_00167452 predicted 668
6 SASI_Hs01_00167453 predicted 382
7 SASI_Hs01_00167455 predicted 348
8 SASI_Hs01_00167456 predicted 1111
9 SASI_Hs02_00303294 predicted 806
10 SASI_Hs01_00167457 predicted 1118
11 SASI_Hs01_00167450 predicted 1096
12 SASI_Hs01_00167454 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245292 predicted 880
2 SASI_Hs01_00245293 predicted 447
3 SASI_Hs02_00368991 predicted 909
4 SASI_Hs01_00245295 predicted 219
5 SASI_Hs01_00245296 predicted 668
6 SASI_Hs01_00245297 predicted 385
7 SASI_Hs01_00245299 predicted 353
8 SASI_Hs01_00245300 predicted 1104
9 SASI_Hs02_00368992 predicted 801
10 SASI_Hs01_00245301 predicted 1122
11 SASI_Hs01_00245294 predicted 1092
12 SASI_Hs01_00245298 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199879 predicted 2610
2 SASI_Rn02_00199880 predicted 654
3 SASI_Rn02_00199881 predicted 2772
4 SASI_Rn02_00199882 predicted 1445
5 SASI_Rn02_00199883 predicted 1192
6 SASI_Rn02_00199884 predicted 2095
7 SASI_Rn02_00199885 predicted 2750
8 SASI_Rn02_00199886 predicted 2440
9 SASI_Rn02_00199887 predicted 2524
10 SASI_Rn02_00199888 predicted 2691
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325246 predicted 2615
2 SASI_Rn02_00325247 predicted 661
3 SASI_Rn02_00325248 predicted 2776
4 SASI_Rn02_00325249 predicted 1442
5 SASI_Rn02_00325250 predicted 1190
6 SASI_Rn02_00325251 predicted 2096
7 SASI_Rn02_00325252 predicted 2758
8 SASI_Rn02_00325253 predicted 2449
9 SASI_Rn02_00325254 predicted 2535
10 SASI_Rn02_00325255 predicted 2689
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400074 predicted 2610
2 SASI_Rn02_00400075 predicted 656
3 SASI_Rn02_00400076 predicted 2767
4 SASI_Rn02_00400077 predicted 1444
5 SASI_Rn02_00400078 predicted 1189
6 SASI_Rn02_00400079 predicted 2095
7 SASI_Rn02_00400080 predicted 2756
8 SASI_Rn02_00400081 predicted 2451
9 SASI_Rn02_00400082 predicted 2530
10 SASI_Rn02_00400083 predicted 2695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136964 predicted 2313
2 SASI_Mm01_00136965 predicted 2633
3 SASI_Mm01_00136966 predicted 451
4 SASI_Mm01_00136967 predicted 472
5 SASI_Mm01_00136968 predicted 1471
6 SASI_Mm01_00136969 predicted 1210
7 SASI_Mm01_00136970 predicted 2527
8 SASI_Mm01_00136971 predicted 2215
9 SASI_Mm01_00136972 predicted 2696
10 SASI_Mm02_00318152 predicted 886
11 SASI_Mm01_00136973 predicted 1885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010256
VALIDATED
GART MISSION shRNA Bacterial Glycerol Stock
phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-1218s21c1
Sequence:CCGGGCTTTAGGACTGCAGGTATTCCTCGAGGAATACCTGCAGTCCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010256.2-2217s21c1
Sequence:CCGGCCTCAGAAGTTTGGAGTAGATCTCGAGATCTACTCCAAACTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-1140s21c1
Sequence:CCGGACCGTCGTCATGGCGAGTAAACTCGAGTTTACTCGCCATGACGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-2978s21c1
Sequence:CCGGAGATGTAGATGCCGGACAAATCTCGAGATTTGTCCGGCATCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-992s21c1
Sequence:CCGGGTTGGAGTTTAATTGCCGCTTCTCGAGAAGCGGCAATTAAACTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-1367s21c1
Sequence:CCGGGTTTGAGGGAGCCATCTATAGCTCGAGCTATAGATGGCTCCCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010256.1-938s1c1
Sequence:CCGGGCTGGTATAATGCTGACCAAACTCGAGTTTGGTCAGCATTATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010256.1-2873s1c1
Sequence:CCGGCCTTCCTTTAAGGGTTCAAATCTCGAGATTTGAACCCTTAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010256.1-2694s1c1
Sequence:CCGGCCAGGGTAATTAATCACAAATCTCGAGATTTGTGATTAATTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010256.1-973s1c1
Sequence:CCGGGTTGGAGTTTAATTGCCGCTTCTCGAGAAGCGGCAATTAAACTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010256.1-2198s1c1
Sequence:CCGGCCTCAGAAGTTTGGAGTAGATCTCGAGATCTACTCCAAACTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010256
VALIDATED
GART MISSION shRNA shRNA Plasmid DNA
phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-1218s21c1
Sequence:CCGGGCTTTAGGACTGCAGGTATTCCTCGAGGAATACCTGCAGTCCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010256.2-2217s21c1
Sequence:CCGGCCTCAGAAGTTTGGAGTAGATCTCGAGATCTACTCCAAACTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-1140s21c1
Sequence:CCGGACCGTCGTCATGGCGAGTAAACTCGAGTTTACTCGCCATGACGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-2978s21c1
Sequence:CCGGAGATGTAGATGCCGGACAAATCTCGAGATTTGTCCGGCATCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-992s21c1
Sequence:CCGGGTTGGAGTTTAATTGCCGCTTCTCGAGAAGCGGCAATTAAACTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-1367s21c1
Sequence:CCGGGTTTGAGGGAGCCATCTATAGCTCGAGCTATAGATGGCTCCCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010256.1-938s1c1
Sequence:CCGGGCTGGTATAATGCTGACCAAACTCGAGTTTGGTCAGCATTATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010256.1-2873s1c1
Sequence:CCGGCCTTCCTTTAAGGGTTCAAATCTCGAGATTTGAACCCTTAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010256.1-2694s1c1
Sequence:CCGGCCAGGGTAATTAATCACAAATCTCGAGATTTGTGATTAATTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010256.1-973s1c1
Sequence:CCGGGTTGGAGTTTAATTGCCGCTTCTCGAGAAGCGGCAATTAAACTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010256.1-2198s1c1
Sequence:CCGGCCTCAGAAGTTTGGAGTAGATCTCGAGATCTACTCCAAACTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010256
VALIDATED
GART MISSION shRNA Lentiviral Transduction Particles
phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-1218s21c1
Sequence:CCGGGCTTTAGGACTGCAGGTATTCCTCGAGGAATACCTGCAGTCCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010256.2-2217s21c1
Sequence:CCGGCCTCAGAAGTTTGGAGTAGATCTCGAGATCTACTCCAAACTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-1140s21c1
Sequence:CCGGACCGTCGTCATGGCGAGTAAACTCGAGTTTACTCGCCATGACGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-2978s21c1
Sequence:CCGGAGATGTAGATGCCGGACAAATCTCGAGATTTGTCCGGCATCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-992s21c1
Sequence:CCGGGTTGGAGTTTAATTGCCGCTTCTCGAGAAGCGGCAATTAAACTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010256.2-1367s21c1
Sequence:CCGGGTTTGAGGGAGCCATCTATAGCTCGAGCTATAGATGGCTCCCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010256.1-938s1c1
Sequence:CCGGGCTGGTATAATGCTGACCAAACTCGAGTTTGGTCAGCATTATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010256.1-2873s1c1
Sequence:CCGGCCTTCCTTTAAGGGTTCAAATCTCGAGATTTGAACCCTTAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010256.1-2694s1c1
Sequence:CCGGCCAGGGTAATTAATCACAAATCTCGAGATTTGTGATTAATTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010256.1-973s1c1
Sequence:CCGGGTTGGAGTTTAATTGCCGCTTCTCGAGAAGCGGCAATTAAACTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010256.1-2198s1c1
Sequence:CCGGCCTCAGAAGTTTGGAGTAGATCTCGAGATCTACTCCAAACTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000819
VALIDATED
GART MISSION shRNA Bacterial Glycerol Stock
phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-2159s21c1
Sequence:CCGGTCAAAGCCTTTGCCCATATTACTCGAGTAATATGGGCAAAGGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-199s21c1
Sequence:CCGGGCACAGTCTCATCATGTCAAACTCGAGTTTGACATGATGAGACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-1136s21c1
Sequence:CCGGCCCTAACTGTTGTCATGGCAACTCGAGTTGCCATGACAACAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-855s21c1
Sequence:CCGGTCAGGTTTCTAATGATCTATTCTCGAGAATAGATCATTAGAAACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-3204s21c1
Sequence:CCGGGAATTATTTGCTGTTTGCATGCTCGAGCATGCAAACAGCAAATAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000819.3-388s1c1
Sequence:CCGGGCTCAGTTAGAGTCCAGCAAACTCGAGTTTGCTGGACTCTAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000819.3-2629s1c1
Sequence:CCGGGCTGGGTTAGATAAAGCGGAACTCGAGTTCCGCTTTATCTAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000819.3-151s1c1
Sequence:CCGGGCACAGTCTCATCATGTCAAACTCGAGTTTGACATGATGAGACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000819.3-1088s1c1
Sequence:CCGGCCCTAACTGTTGTCATGGCAACTCGAGTTGCCATGACAACAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000819
VALIDATED
GART MISSION shRNA shRNA Plasmid DNA
phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-2159s21c1
Sequence:CCGGTCAAAGCCTTTGCCCATATTACTCGAGTAATATGGGCAAAGGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-199s21c1
Sequence:CCGGGCACAGTCTCATCATGTCAAACTCGAGTTTGACATGATGAGACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-1136s21c1
Sequence:CCGGCCCTAACTGTTGTCATGGCAACTCGAGTTGCCATGACAACAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-855s21c1
Sequence:CCGGTCAGGTTTCTAATGATCTATTCTCGAGAATAGATCATTAGAAACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-3204s21c1
Sequence:CCGGGAATTATTTGCTGTTTGCATGCTCGAGCATGCAAACAGCAAATAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000819.3-388s1c1
Sequence:CCGGGCTCAGTTAGAGTCCAGCAAACTCGAGTTTGCTGGACTCTAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000819.3-2629s1c1
Sequence:CCGGGCTGGGTTAGATAAAGCGGAACTCGAGTTCCGCTTTATCTAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000819.3-151s1c1
Sequence:CCGGGCACAGTCTCATCATGTCAAACTCGAGTTTGACATGATGAGACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000819.3-1088s1c1
Sequence:CCGGCCCTAACTGTTGTCATGGCAACTCGAGTTGCCATGACAACAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000819
VALIDATED
GART MISSION shRNA Lentiviral Transduction Particles
phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-2159s21c1
Sequence:CCGGTCAAAGCCTTTGCCCATATTACTCGAGTAATATGGGCAAAGGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-199s21c1
Sequence:CCGGGCACAGTCTCATCATGTCAAACTCGAGTTTGACATGATGAGACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-1136s21c1
Sequence:CCGGCCCTAACTGTTGTCATGGCAACTCGAGTTGCCATGACAACAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-855s21c1
Sequence:CCGGTCAGGTTTCTAATGATCTATTCTCGAGAATAGATCATTAGAAACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_000819.4-3204s21c1
Sequence:CCGGGAATTATTTGCTGTTTGCATGCTCGAGCATGCAAACAGCAAATAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000819.3-388s1c1
Sequence:CCGGGCTCAGTTAGAGTCCAGCAAACTCGAGTTTGCTGGACTCTAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000819.3-2629s1c1
Sequence:CCGGGCTGGGTTAGATAAAGCGGAACTCGAGTTCCGCTTTATCTAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000819.3-151s1c1
Sequence:CCGGGCACAGTCTCATCATGTCAAACTCGAGTTTGACATGATGAGACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000819.3-1088s1c1
Sequence:CCGGCCCTAACTGTTGTCATGGCAACTCGAGTTGCCATGACAACAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks