EMAIL THIS PAGE TO A FRIEND

GAS1

growth arrest-specific 1

UniProtKB ID: P54826, B9EGM4, Q6B086
Gene ID:
Human(2619) Summary: Growth arrest-specific 1 plays a role in growth suppression. GAS1 blocks entry to S phase and prevents cycling of normal and transformed cells. Gas1 is a putative tumor suppressor gene. [provided by RefSeq, Jul 2008]
Mouse(14451) growth arrest specific 1
Rat(683470) growth arrest-specific 1
Rat(83818) growth arrest specific 1
chicken(770168) growth arrest-specific 1
cow(540336) growth arrest-specific 1
dog(607496) growth arrest-specific 1
naked mole-rat(101726097) growth arrest-specific 1
sheep(101114683) growth arrest-specific 1
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002048 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008086 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008086 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008086 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002048 Rosetta Predictions human pricing
XM_001066058 Rosetta Predictions rat pricing
NM_008086 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023966 predicted 1636
2 SASI_Hs01_00023970 predicted 1096
3 SASI_Hs01_00023967 predicted 1608
4 SASI_Hs01_00023968 predicted 1631
5 SASI_Hs01_00023969 predicted 1639
6 SASI_Hs02_00333088 predicted 1644
7 SASI_Hs01_00023972 predicted 732
8 SASI_Hs01_00023973 predicted 970
9 SASI_Hs01_00023974 predicted 1027
10 SASI_Hs01_00023975 predicted 1860
11 SASI_Hs01_00023971 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316189 predicted 1498
2 SASI_Rn02_00316190 predicted 1850
3 SASI_Rn02_00316191 predicted 1391
4 SASI_Rn02_00316192 predicted 1897
5 SASI_Rn02_00316193 predicted 1498
6 SASI_Rn02_00316194 predicted 611
7 SASI_Rn02_00316195 predicted 1190
8 SASI_Rn02_00316196 predicted 1330
9 SASI_Rn02_00316197 predicted 1270
10 SASI_Rn02_00316198 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083125 predicted 851
2 SASI_Mm01_00083126 predicted 1689
3 SASI_Mm01_00083127 predicted 1311
4 SASI_Mm01_00083128 predicted 1091
5 SASI_Mm01_00083129 predicted 1317
6 SASI_Mm01_00083130 predicted 435
7 SASI_Mm01_00083131 predicted 1015
8 SASI_Mm01_00083132 predicted 854
9 SASI_Mm01_00083133 predicted 1678
10 SASI_Mm01_00083134 predicted 753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002048
GAS1 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002048.1-2235s1c1
Sequence:CCGGGCCATGTATGAAAGTCTCTTTCTCGAGAAAGAGACTTTCATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002048.1-1019s1c1
Sequence:CCGGCCGCACCGTCATTGAGGACATCTCGAGATGTCCTCAATGACGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002048.1-1028s1c1
Sequence:CCGGCATTGAGGACATGCTGGCTATCTCGAGATAGCCAGCATGTCCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002048.1-740s1c1
Sequence:CCGGCTCGGCCCTCATTCAGCTCAACTCGAGTTGAGCTGAATGAGGGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002048.1-584s1c1
Sequence:CCGGGCCGGAGTGCAGCTACGCCTACTCGAGTAGGCGTAGCTGCACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002048.2-973s21c1
Sequence:CCGGCCTACTGCGGCAAAGTCTTCACTCGAGTGAAGACTTTGCCGCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002048.2-1198s21c1
Sequence:CCGGACTACTACGATGAGGACTACGCTCGAGCGTAGTCCTCATCGTAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002048.2-1679s21c1
Sequence:CCGGCCAATTCCAAGCTCCAGAAACCTCGAGGTTTCTGGAGCTTGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002048.2-1867s21c1
Sequence:CCGGGGGCTGTCTATTAGCATATTTCTCGAGAAATATGCTAATAGACAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002048
GAS1 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002048.1-2235s1c1
Sequence:CCGGGCCATGTATGAAAGTCTCTTTCTCGAGAAAGAGACTTTCATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002048.1-1019s1c1
Sequence:CCGGCCGCACCGTCATTGAGGACATCTCGAGATGTCCTCAATGACGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002048.1-1028s1c1
Sequence:CCGGCATTGAGGACATGCTGGCTATCTCGAGATAGCCAGCATGTCCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002048.1-740s1c1
Sequence:CCGGCTCGGCCCTCATTCAGCTCAACTCGAGTTGAGCTGAATGAGGGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002048.1-584s1c1
Sequence:CCGGGCCGGAGTGCAGCTACGCCTACTCGAGTAGGCGTAGCTGCACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002048.2-973s21c1
Sequence:CCGGCCTACTGCGGCAAAGTCTTCACTCGAGTGAAGACTTTGCCGCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002048.2-1198s21c1
Sequence:CCGGACTACTACGATGAGGACTACGCTCGAGCGTAGTCCTCATCGTAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002048.2-1679s21c1
Sequence:CCGGCCAATTCCAAGCTCCAGAAACCTCGAGGTTTCTGGAGCTTGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002048.2-1867s21c1
Sequence:CCGGGGGCTGTCTATTAGCATATTTCTCGAGAAATATGCTAATAGACAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002048
GAS1 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002048.1-2235s1c1
Sequence:CCGGGCCATGTATGAAAGTCTCTTTCTCGAGAAAGAGACTTTCATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002048.1-1019s1c1
Sequence:CCGGCCGCACCGTCATTGAGGACATCTCGAGATGTCCTCAATGACGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002048.1-1028s1c1
Sequence:CCGGCATTGAGGACATGCTGGCTATCTCGAGATAGCCAGCATGTCCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002048.1-740s1c1
Sequence:CCGGCTCGGCCCTCATTCAGCTCAACTCGAGTTGAGCTGAATGAGGGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002048.1-584s1c1
Sequence:CCGGGCCGGAGTGCAGCTACGCCTACTCGAGTAGGCGTAGCTGCACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002048.2-973s21c1
Sequence:CCGGCCTACTGCGGCAAAGTCTTCACTCGAGTGAAGACTTTGCCGCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002048.2-1198s21c1
Sequence:CCGGACTACTACGATGAGGACTACGCTCGAGCGTAGTCCTCATCGTAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002048.2-1679s21c1
Sequence:CCGGCCAATTCCAAGCTCCAGAAACCTCGAGGTTTCTGGAGCTTGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002048.2-1867s21c1
Sequence:CCGGGGGCTGTCTATTAGCATATTTCTCGAGAAATATGCTAATAGACAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008086
VALIDATED
GAS1 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008086.1-2159s1c1
Sequence:CCGGCCGAAATTACAACTGCATTATCTCGAGATAATGCAGTTGTAATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008086.1-1231s1c1
Sequence:CCGGCGAATCGGTCAAAGAGAACATCTCGAGATGTTCTCTTTGACCGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008086.1-1330s1c1
Sequence:CCGGCGACGAAGAATATGACGACGACTCGAGTCGTCGTCATATTCTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008086.1-452s1c1
Sequence:CCGGGCGCGGAACTCGGACAAACTTCTCGAGAAGTTTGTCCGAGTTCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008086.1-1321s1c1
Sequence:CCGGCGACTACTACGACGAAGAATACTCGAGTATTCTTCGTCGTAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008086.1-1321s21c1
Sequence:CCGGCGACTACTACGACGAAGAATACTCGAGTATTCTTCGTCGTAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008086.1-2159s21c1
Sequence:CCGGCCGAAATTACAACTGCATTATCTCGAGATAATGCAGTTGTAATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008086.1-1231s21c1
Sequence:CCGGCGAATCGGTCAAAGAGAACATCTCGAGATGTTCTCTTTGACCGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008086.1-1330s21c1
Sequence:CCGGCGACGAAGAATATGACGACGACTCGAGTCGTCGTCATATTCTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008086
VALIDATED
GAS1 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008086.1-2159s1c1
Sequence:CCGGCCGAAATTACAACTGCATTATCTCGAGATAATGCAGTTGTAATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008086.1-1231s1c1
Sequence:CCGGCGAATCGGTCAAAGAGAACATCTCGAGATGTTCTCTTTGACCGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008086.1-1330s1c1
Sequence:CCGGCGACGAAGAATATGACGACGACTCGAGTCGTCGTCATATTCTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008086.1-452s1c1
Sequence:CCGGGCGCGGAACTCGGACAAACTTCTCGAGAAGTTTGTCCGAGTTCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008086.1-1321s1c1
Sequence:CCGGCGACTACTACGACGAAGAATACTCGAGTATTCTTCGTCGTAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008086.1-1321s21c1
Sequence:CCGGCGACTACTACGACGAAGAATACTCGAGTATTCTTCGTCGTAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008086.1-2159s21c1
Sequence:CCGGCCGAAATTACAACTGCATTATCTCGAGATAATGCAGTTGTAATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008086.1-1231s21c1
Sequence:CCGGCGAATCGGTCAAAGAGAACATCTCGAGATGTTCTCTTTGACCGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008086.1-1330s21c1
Sequence:CCGGCGACGAAGAATATGACGACGACTCGAGTCGTCGTCATATTCTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008086
VALIDATED
GAS1 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008086.1-2159s1c1
Sequence:CCGGCCGAAATTACAACTGCATTATCTCGAGATAATGCAGTTGTAATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008086.1-1231s1c1
Sequence:CCGGCGAATCGGTCAAAGAGAACATCTCGAGATGTTCTCTTTGACCGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008086.1-1330s1c1
Sequence:CCGGCGACGAAGAATATGACGACGACTCGAGTCGTCGTCATATTCTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008086.1-452s1c1
Sequence:CCGGGCGCGGAACTCGGACAAACTTCTCGAGAAGTTTGTCCGAGTTCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008086.1-1321s1c1
Sequence:CCGGCGACTACTACGACGAAGAATACTCGAGTATTCTTCGTCGTAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008086.1-1321s21c1
Sequence:CCGGCGACTACTACGACGAAGAATACTCGAGTATTCTTCGTCGTAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008086.1-2159s21c1
Sequence:CCGGCCGAAATTACAACTGCATTATCTCGAGATAATGCAGTTGTAATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008086.1-1231s21c1
Sequence:CCGGCGAATCGGTCAAAGAGAACATCTCGAGATGTTCTCTTTGACCGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008086.1-1330s21c1
Sequence:CCGGCGACGAAGAATATGACGACGACTCGAGTCGTCGTCATATTCTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks