EMAIL THIS PAGE TO A FRIEND

GAS2

growth arrest-specific 2

156 Gene Product Result for
UniProtKB ID: O43903, B2R9C8, D3DQZ0, Q6ICV8
Gene ID:
Human(2620) Summary: The protein encoded by this gene is a caspase-3 substrate that plays a role in regulating microfilament and cell shape changes during apoptosis. It can also modulate cell susceptibility to p53-dependent apoptosis by inhibiting calpain activity. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2009]
Mouse(14453) growth arrest specific 2
Rat(499156) growth arrest-specific 2
chicken(422970) growth arrest-specific 2
domestic cat(101086419) growth arrest-specific 2
cow(614840) growth arrest-specific 2
dog(476889) growth arrest-specific 2
sheep(101112173) growth arrest-specific 2
domestic guinea pig(100728870) growth arrest-specific 2
naked mole-rat(101698369) growth arrest-specific 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005256 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005256 Rosetta Predictions human pricing
NM_177553 Rosetta Predictions human pricing
NM_001127504 Rosetta Predictions rat pricing
XM_574454 Rosetta Predictions rat pricing
NM_008087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105147 predicted 1038
2 SASI_Hs02_00339284 predicted 693
3 SASI_Hs01_00105149 predicted 428
4 SASI_Hs01_00105150 predicted 315
5 SASI_Hs01_00105151 predicted 681
6 SASI_Hs01_00105152 predicted 934
7 SASI_Hs01_00105153 predicted 1054
8 SASI_Hs01_00105154 predicted 543
9 SASI_Hs01_00105155 predicted 383
10 SASI_Hs01_00105156 predicted 302
11 SASI_Hs01_00105148 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163886 predicted 1225
2 SASI_Hs02_00369403 predicted 883
3 SASI_Hs01_00163888 predicted 616
4 SASI_Hs01_00163889 predicted 510
5 SASI_Hs01_00163890 predicted 874
6 SASI_Hs01_00163891 predicted 1120
7 SASI_Hs01_00163892 predicted 1241
8 SASI_Hs01_00163893 predicted 731
9 SASI_Hs01_00163894 predicted 573
10 SASI_Hs01_00163895 predicted 496
11 SASI_Hs01_00163887 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253953 predicted 263
2 SASI_Rn02_00253954 predicted 772
3 SASI_Rn02_00253955 predicted 802
4 SASI_Rn02_00253956 predicted 464
5 SASI_Rn02_00253957 predicted 457
6 SASI_Rn02_00253958 predicted 1124
7 SASI_Rn02_00253959 predicted 976
8 SASI_Rn02_00253960 predicted 686
9 SASI_Rn02_00253961 predicted 433
10 SASI_Rn02_00253962 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167233 predicted 381
2 SASI_Rn01_00167234 predicted 453
3 SASI_Rn01_00167235 predicted 966
4 SASI_Rn01_00167236 predicted 997
5 SASI_Rn01_00167237 predicted 659
6 SASI_Rn01_00167238 predicted 657
7 SASI_Rn01_00167239 predicted 1315
8 SASI_Rn01_00167240 predicted 1171
9 SASI_Rn01_00167241 predicted 632
10 SASI_Rn01_00167242 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122513 predicted 606
2 SASI_Mm01_00122514 predicted 1122
3 SASI_Mm01_00122515 predicted 405
4 SASI_Mm01_00122516 predicted 942
5 SASI_Mm01_00122517 predicted 829
6 SASI_Mm01_00122518 predicted 918
7 SASI_Mm01_00122519 predicted 616
8 SASI_Mm01_00122520 predicted 579
9 SASI_Mm02_00313104 predicted 1161
10 SASI_Mm01_00122521 predicted 1233
11 SASI_Mm01_00122522 predicted 1226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005256
GAS2 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005256.3-1475s21c1
Sequence:CCGGATGATGATTAGTGTGATAATGCTCGAGCATTATCACACTAATCATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005256.2-1727s1c1
Sequence:CCGGCGTTGATACTTTGACGAGTAACTCGAGTTACTCGTCAAAGTATCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005256.2-319s1c1
Sequence:CCGGGCCCACAAAGAATCTACCGTTCTCGAGAACGGTAGATTCTTTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005256.2-551s1c1
Sequence:CCGGCCTGGTTTGATAAAGCTGGAACTCGAGTTCCAGCTTTATCAAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005256.2-387s1c1
Sequence:CCGGCCAGAGACAATACAGCAAATTCTCGAGAATTTGCTGTATTGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005256.2-448s1c1
Sequence:CCGGTCTATTTGAATCGGAAGGTTTCTCGAGAAACCTTCCGATTCAAATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005256
GAS2 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005256.3-1475s21c1
Sequence:CCGGATGATGATTAGTGTGATAATGCTCGAGCATTATCACACTAATCATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005256.2-1727s1c1
Sequence:CCGGCGTTGATACTTTGACGAGTAACTCGAGTTACTCGTCAAAGTATCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005256.2-319s1c1
Sequence:CCGGGCCCACAAAGAATCTACCGTTCTCGAGAACGGTAGATTCTTTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005256.2-551s1c1
Sequence:CCGGCCTGGTTTGATAAAGCTGGAACTCGAGTTCCAGCTTTATCAAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005256.2-387s1c1
Sequence:CCGGCCAGAGACAATACAGCAAATTCTCGAGAATTTGCTGTATTGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005256.2-448s1c1
Sequence:CCGGTCTATTTGAATCGGAAGGTTTCTCGAGAAACCTTCCGATTCAAATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005256
GAS2 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005256.3-1475s21c1
Sequence:CCGGATGATGATTAGTGTGATAATGCTCGAGCATTATCACACTAATCATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005256.2-1727s1c1
Sequence:CCGGCGTTGATACTTTGACGAGTAACTCGAGTTACTCGTCAAAGTATCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005256.2-319s1c1
Sequence:CCGGGCCCACAAAGAATCTACCGTTCTCGAGAACGGTAGATTCTTTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005256.2-551s1c1
Sequence:CCGGCCTGGTTTGATAAAGCTGGAACTCGAGTTCCAGCTTTATCAAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005256.2-387s1c1
Sequence:CCGGCCAGAGACAATACAGCAAATTCTCGAGAATTTGCTGTATTGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005256.2-448s1c1
Sequence:CCGGTCTATTTGAATCGGAAGGTTTCTCGAGAAACCTTCCGATTCAAATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008087
VALIDATED
GAS2 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008087.2-672s21c1
Sequence:CCGGCCGAGAAGTGTGTCTCTGTTTCTCGAGAAACAGAGACACACTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008087.2-1293s21c1
Sequence:CCGGCTCAAATGGTAGCACTATTTACTCGAGTAAATAGTGCTACCATTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008087.2-368s21c1
Sequence:CCGGCCTTGTGGTTAACCAATCTATCTCGAGATAGATTGGTTAACCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008087.2-345s21c1
Sequence:CCGGGCTGCCGATGAAAGAAGACTTCTCGAGAAGTCTTCTTTCATCGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-1664s1c1
Sequence:CCGGGCCATAATACTTAACTGGAAACTCGAGTTTCCAGTTAAGTATTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-368s1c1
Sequence:CCGGCCTTGTGGTTAACCAATCTATCTCGAGATAGATTGGTTAACCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-345s1c1
Sequence:CCGGGCTGCCGATGAAAGAAGACTTCTCGAGAAGTCTTCTTTCATCGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-672s1c1
Sequence:CCGGCCGAGAAGTGTGTCTCTGTTTCTCGAGAAACAGAGACACACTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-1111s1c1
Sequence:CCGGCCAACCCTGAAGGACATGAATCTCGAGATTCATGTCCTTCAGGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008087
VALIDATED
GAS2 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008087.2-672s21c1
Sequence:CCGGCCGAGAAGTGTGTCTCTGTTTCTCGAGAAACAGAGACACACTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008087.2-1293s21c1
Sequence:CCGGCTCAAATGGTAGCACTATTTACTCGAGTAAATAGTGCTACCATTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008087.2-368s21c1
Sequence:CCGGCCTTGTGGTTAACCAATCTATCTCGAGATAGATTGGTTAACCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008087.2-345s21c1
Sequence:CCGGGCTGCCGATGAAAGAAGACTTCTCGAGAAGTCTTCTTTCATCGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-1664s1c1
Sequence:CCGGGCCATAATACTTAACTGGAAACTCGAGTTTCCAGTTAAGTATTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-368s1c1
Sequence:CCGGCCTTGTGGTTAACCAATCTATCTCGAGATAGATTGGTTAACCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-345s1c1
Sequence:CCGGGCTGCCGATGAAAGAAGACTTCTCGAGAAGTCTTCTTTCATCGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-672s1c1
Sequence:CCGGCCGAGAAGTGTGTCTCTGTTTCTCGAGAAACAGAGACACACTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-1111s1c1
Sequence:CCGGCCAACCCTGAAGGACATGAATCTCGAGATTCATGTCCTTCAGGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008087
VALIDATED
GAS2 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008087.2-672s21c1
Sequence:CCGGCCGAGAAGTGTGTCTCTGTTTCTCGAGAAACAGAGACACACTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008087.2-1293s21c1
Sequence:CCGGCTCAAATGGTAGCACTATTTACTCGAGTAAATAGTGCTACCATTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008087.2-368s21c1
Sequence:CCGGCCTTGTGGTTAACCAATCTATCTCGAGATAGATTGGTTAACCACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008087.2-345s21c1
Sequence:CCGGGCTGCCGATGAAAGAAGACTTCTCGAGAAGTCTTCTTTCATCGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-1664s1c1
Sequence:CCGGGCCATAATACTTAACTGGAAACTCGAGTTTCCAGTTAAGTATTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-368s1c1
Sequence:CCGGCCTTGTGGTTAACCAATCTATCTCGAGATAGATTGGTTAACCACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-345s1c1
Sequence:CCGGGCTGCCGATGAAAGAAGACTTCTCGAGAAGTCTTCTTTCATCGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-672s1c1
Sequence:CCGGCCGAGAAGTGTGTCTCTGTTTCTCGAGAAACAGAGACACACTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008087.1-1111s1c1
Sequence:CCGGCCAACCCTGAAGGACATGAATCTCGAGATTCATGTCCTTCAGGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)