EMAIL THIS PAGE TO A FRIEND

GAS2L1

growth arrest-specific 2 like 1

94 Gene Product Result for
Synonyms: GAR22
UniProtKB ID: Q99501, Q53EN7, Q92640, Q9BUY9
Gene ID:
Human(10634) Summary: This gene encodes a member of the growth arrest-specific 2 protein family. This protein binds components of the cytoskeleton and may be involved in mediating interactions between microtubules and microfilaments. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 9. [provided by RefSeq, Jul 2013]
Mouse(78926) growth arrest-specific 2 like 1
Rat(360973) growth arrest-specific 2 like 1
cow(518935) growth arrest-specific 2 like 1
dog(486342) growth arrest-specific 2 like 1
domestic cat(101086602) growth arrest-specific 2 like 1
naked mole-rat(101701802) growth arrest-specific 2 like 1
domestic guinea pig(100717979) growth arrest-specific 2 like 1
sheep(101107225) growth arrest-specific 2 like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407030 Anti-GAS2L1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2100895 Anti-GAS2L1 antibody produced in rabbit affinity isolated antibody bovine, human, mouse, canine, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030228 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030228 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030228 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006478 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152237 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006478 Rosetta Predictions human pricing
NM_152236 Rosetta Predictions human pricing
NM_152237 Rosetta Predictions human pricing
NM_001108365 Rosetta Predictions rat pricing
NM_030228 Rosetta Predictions mouse pricing
NM_144560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153525 predicted 2286
2 SASI_Hs02_00341662 predicted 442
3 SASI_Hs01_00153526 predicted 2109
4 SASI_Hs01_00153527 predicted 2093
5 SASI_Hs01_00153528 predicted 1975
6 SASI_Hs01_00153529 predicted 1928
7 SASI_Hs01_00153530 predicted 450
8 SASI_Hs01_00153531 predicted 658
9 SASI_Hs01_00153532 predicted 851
10 SASI_Hs01_00153533 predicted 907
11 SASI_Hs01_00153534 predicted 2286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213413 predicted 2289
2 SASI_Hs02_00365735 predicted 449
3 SASI_Hs01_00213414 predicted 2114
4 SASI_Hs01_00213415 predicted 2098
5 SASI_Hs01_00213416 predicted 1984
6 SASI_Hs01_00213417 predicted 1941
7 SASI_Hs01_00213418 predicted 451
8 SASI_Hs01_00213419 predicted 663
9 SASI_Hs01_00213420 predicted 858
10 SASI_Hs01_00213421 predicted 913
11 SASI_Hs01_00213422 predicted 2295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365736 predicted 422
2 SASI_Hs01_00080755 predicted 422
3 SASI_Hs01_00080756 predicted 632
4 SASI_Hs01_00080757 predicted 823
5 SASI_Hs01_00080758 predicted 873
6 SASI_Hs02_00365737 predicted 1415
7 SASI_Hs01_00080760 predicted 194
8 SASI_Hs01_00080761 predicted 1125
9 SASI_Hs01_00080762 predicted 1542
10 SASI_Hs01_00080763 predicted 1128
11 SASI_Hs01_00080759 predicted 1269
12 SASI_Hs01_00080764 predicted 1431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237949 predicted 399
2 SASI_Rn02_00237950 predicted 1158
3 SASI_Rn02_00237951 predicted 712
4 SASI_Rn02_00237952 predicted 1171
5 SASI_Rn02_00237953 predicted 1321
6 SASI_Rn02_00237954 predicted 1029
7 SASI_Rn02_00237955 predicted 1611
8 SASI_Rn02_00237956 predicted 1151
9 SASI_Rn02_00237957 predicted 1542
10 SASI_Rn02_00237958 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129437 predicted 382
2 SASI_Mm01_00129438 predicted 220
3 SASI_Mm01_00129439 predicted 217
4 SASI_Mm01_00129440 predicted 327
5 SASI_Mm01_00129441 predicted 635
6 SASI_Mm01_00129442 predicted 412
7 SASI_Mm01_00129443 predicted 814
8 SASI_Mm02_00336668 predicted 822
9 SASI_Mm01_00129445 predicted 770
10 SASI_Mm01_00129446 predicted 583
11 SASI_Mm01_00129444 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071188 predicted 2572
2 SASI_Mm01_00071189 predicted 2527
3 SASI_Mm01_00071190 predicted 2570
4 SASI_Mm01_00071191 predicted 703
5 SASI_Mm01_00071192 predicted 540
6 SASI_Mm01_00071194 predicted 2137
7 SASI_Mm01_00071195 predicted 2275
8 SASI_Mm01_00071196 predicted 737
9 SASI_Mm01_00071197 predicted 1145
10 SASI_Mm02_00340117 predicted 2060
11 SASI_Mm01_00071193 predicted 1934
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030228
VALIDATED
GAS2L1 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 2 like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030228.1-573s1c1
Sequence:CCGGGCTGAAGAGGATGTCACTGAACTCGAGTTCAGTGACATCCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030228.1-2449s1c1
Sequence:CCGGGCCTTAACCTACCCTTTGCATCTCGAGATGCAAAGGGTAGGTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030228.1-392s1c1
Sequence:CCGGGCTCATGTTTGAGACAGAGGACTCGAGTCCTCTGTCTCAAACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030228.2-636s21c1
Sequence:CCGGACGCCCAATGACCTTCGAAACCTCGAGGTTTCGAAGGTCATTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030228.2-134s21c1
Sequence:CCGGGGCCGATTGGCTCAATGCTTTCTCGAGAAAGCATTGAGCCAATCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030228.2-2574s21c1
Sequence:CCGGGGGATGAGCATTGCTATTTAACTCGAGTTAAATAGCAATGCTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030228.2-382s21c1
Sequence:CCGGTGCCTGAAGTGCTCATGTTTGCTCGAGCAAACATGAGCACTTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030228.2-702s21c1
Sequence:CCGGGACCAGTTTCCCATGATCAAGCTCGAGCTTGATCATGGGAAACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030228
VALIDATED
GAS2L1 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 2 like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030228.1-573s1c1
Sequence:CCGGGCTGAAGAGGATGTCACTGAACTCGAGTTCAGTGACATCCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030228.1-2449s1c1
Sequence:CCGGGCCTTAACCTACCCTTTGCATCTCGAGATGCAAAGGGTAGGTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030228.1-392s1c1
Sequence:CCGGGCTCATGTTTGAGACAGAGGACTCGAGTCCTCTGTCTCAAACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030228.2-636s21c1
Sequence:CCGGACGCCCAATGACCTTCGAAACCTCGAGGTTTCGAAGGTCATTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030228.2-134s21c1
Sequence:CCGGGGCCGATTGGCTCAATGCTTTCTCGAGAAAGCATTGAGCCAATCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030228.2-2574s21c1
Sequence:CCGGGGGATGAGCATTGCTATTTAACTCGAGTTAAATAGCAATGCTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030228.2-382s21c1
Sequence:CCGGTGCCTGAAGTGCTCATGTTTGCTCGAGCAAACATGAGCACTTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030228.2-702s21c1
Sequence:CCGGGACCAGTTTCCCATGATCAAGCTCGAGCTTGATCATGGGAAACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030228
VALIDATED
GAS2L1 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 2 like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030228.1-573s1c1
Sequence:CCGGGCTGAAGAGGATGTCACTGAACTCGAGTTCAGTGACATCCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030228.1-2449s1c1
Sequence:CCGGGCCTTAACCTACCCTTTGCATCTCGAGATGCAAAGGGTAGGTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030228.1-392s1c1
Sequence:CCGGGCTCATGTTTGAGACAGAGGACTCGAGTCCTCTGTCTCAAACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030228.2-636s21c1
Sequence:CCGGACGCCCAATGACCTTCGAAACCTCGAGGTTTCGAAGGTCATTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030228.2-134s21c1
Sequence:CCGGGGCCGATTGGCTCAATGCTTTCTCGAGAAAGCATTGAGCCAATCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030228.2-2574s21c1
Sequence:CCGGGGGATGAGCATTGCTATTTAACTCGAGTTAAATAGCAATGCTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030228.2-382s21c1
Sequence:CCGGTGCCTGAAGTGCTCATGTTTGCTCGAGCAAACATGAGCACTTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030228.2-702s21c1
Sequence:CCGGGACCAGTTTCCCATGATCAAGCTCGAGCTTGATCATGGGAAACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006478
GAS2L1 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 2 like 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000184129    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006478.3-2327s1c1
Sequence:CCGGCTCTTGAGTACCAGACCTCATCTCGAGATGAGGTCTGGTACTCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006478.3-1159s1c1
Sequence:CCGGCCGTTAGCTTACGAAGCACAACTCGAGTTGTGCTTCGTAAGCTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006478.3-1149s1c1
Sequence:CCGGGAGATGACTCCCGTTAGCTTACTCGAGTAAGCTAACGGGAGTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006478
GAS2L1 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 2 like 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000184129    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006478.3-2327s1c1
Sequence:CCGGCTCTTGAGTACCAGACCTCATCTCGAGATGAGGTCTGGTACTCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006478.3-1159s1c1
Sequence:CCGGCCGTTAGCTTACGAAGCACAACTCGAGTTGTGCTTCGTAAGCTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006478.3-1149s1c1
Sequence:CCGGGAGATGACTCCCGTTAGCTTACTCGAGTAAGCTAACGGGAGTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006478
GAS2L1 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 2 like 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000184129    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006478.3-2327s1c1
Sequence:CCGGCTCTTGAGTACCAGACCTCATCTCGAGATGAGGTCTGGTACTCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006478.3-1159s1c1
Sequence:CCGGCCGTTAGCTTACGAAGCACAACTCGAGTTGTGCTTCGTAAGCTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006478.3-1149s1c1
Sequence:CCGGGAGATGACTCCCGTTAGCTTACTCGAGTAAGCTAACGGGAGTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152237
GAS2L1 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 2 like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152237.1-1327s1c1
Sequence:CCGGGCAACCCAACCAAACCAACAACTCGAGTTGTTGGTTTGGTTGGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152237.1-831s1c1
Sequence:CCGGCTGACCAGTTTCCCATGATCACTCGAGTGATCATGGGAAACTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152237.1-220s21c1
Sequence:CCGGATTTCGCTCCAGTGAGGCCTACTCGAGTAGGCCTCACTGGAGCGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152237.1-1552s21c1
Sequence:CCGGCACATACCCTGCTGTTCCTCTCTCGAGAGAGGAACAGCAGGGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152237.1-963s21c1
Sequence:CCGGATTACCTGGACAAGCACGACCCTCGAGGGTCGTGCTTGTCCAGGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152237
GAS2L1 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 2 like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152237.1-1327s1c1
Sequence:CCGGGCAACCCAACCAAACCAACAACTCGAGTTGTTGGTTTGGTTGGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152237.1-831s1c1
Sequence:CCGGCTGACCAGTTTCCCATGATCACTCGAGTGATCATGGGAAACTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152237.1-220s21c1
Sequence:CCGGATTTCGCTCCAGTGAGGCCTACTCGAGTAGGCCTCACTGGAGCGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152237.1-1552s21c1
Sequence:CCGGCACATACCCTGCTGTTCCTCTCTCGAGAGAGGAACAGCAGGGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152237.1-963s21c1
Sequence:CCGGATTACCTGGACAAGCACGACCCTCGAGGGTCGTGCTTGTCCAGGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152237
GAS2L1 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 2 like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152237.1-1327s1c1
Sequence:CCGGGCAACCCAACCAAACCAACAACTCGAGTTGTTGGTTTGGTTGGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152237.1-831s1c1
Sequence:CCGGCTGACCAGTTTCCCATGATCACTCGAGTGATCATGGGAAACTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152237.1-220s21c1
Sequence:CCGGATTTCGCTCCAGTGAGGCCTACTCGAGTAGGCCTCACTGGAGCGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152237.1-1552s21c1
Sequence:CCGGCACATACCCTGCTGTTCCTCTCTCGAGAGAGGAACAGCAGGGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152237.1-963s21c1
Sequence:CCGGATTACCTGGACAAGCACGACCCTCGAGGGTCGTGCTTGTCCAGGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks