EMAIL THIS PAGE TO A FRIEND

GAS2L2

growth arrest-specific 2 like 2

Synonyms: GAR17
UniProtKB ID: Q8NHY3, Q8NHY4
Gene ID:
Human(246176) Summary: The protein encoded by this gene appears to crosslink microtubules and microfilaments and may be part of the cytoskeleton. This gene is mainly expressed in skeletal muscle. [provided by RefSeq, Jul 2011]
Mouse(237891) growth arrest-specific 2 like 2
Rat(287570) growth arrest-specific 2 like 2
sheep(101112583) growth arrest-specific 2 like 2
Domestic Rabbit(100353961) growth arrest-specific 2 like 2
domestic guinea pig(100713647) growth arrest-specific 2 like 2
naked mole-rat(101710694) growth arrest-specific 2 like 2
chicken(427821) growth arrest-specific 2 like 2
cow(539169) growth arrest-specific 2 like 2
domestic cat(101080841) growth arrest-specific 2 like 2
Horse(100071581) growth arrest-specific 2 like 2
dog(491137) growth arrest-specific 2 like 2
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139285 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU210341 MISSION® esiRNA esiRNA targeting mouse Gas2l2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139285 Rosetta Predictions human pricing
NM_001013759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246194 predicted 1966
2 SASI_Hs01_00246195 predicted 1348
3 SASI_Hs01_00246196 predicted 1490
4 SASI_Hs01_00246197 predicted 2280
5 SASI_Hs01_00246198 predicted 2193
6 SASI_Hs01_00246199 predicted 1848
7 SASI_Hs01_00246200 predicted 2156
8 SASI_Hs01_00246201 predicted 1269
9 SASI_Hs01_00246202 predicted 1821
10 SASI_Hs01_00246203 predicted 1819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138289 predicted 353
2 SASI_Mm01_00138290 predicted 2271
3 SASI_Mm02_00287293 predicted 444
4 SASI_Mm01_00138292 predicted 2302
5 SASI_Mm01_00138293 predicted 1539
6 SASI_Mm01_00138294 predicted 1927
7 SASI_Mm01_00138295 predicted 687
8 SASI_Mm01_00138296 predicted 1775
9 SASI_Mm01_00138297 predicted 1253
10 SASI_Mm01_00138298 predicted 2098
11 SASI_Mm01_00138291 predicted 2231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139285
GAS2L2 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 2 like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139285.2-988s21c1
Sequence:CCGGTGTGGACTGGAAGACATATACCTCGAGGTATATGTCTTCCAGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139285.2-2615s21c1
Sequence:CCGGCAACCTCACTGGCTTAATCAACTCGAGTTGATTAAGCCAGTGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139285.2-2787s21c1
Sequence:CCGGGGAGTGGGTCAGAAGACAAATCTCGAGATTTGTCTTCTGACCCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139285.2-690s21c1
Sequence:CCGGTGCAGTTCTCCATGGTCAAAGCTCGAGCTTTGACCATGGAGAACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-1365s1c1
Sequence:CCGGCCACCAAAGGGATATCAGCAACTCGAGTTGCTGATATCCCTTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-376s1c1
Sequence:CCGGCTTCATCCAGTGGTGTCGAAACTCGAGTTTCGACACCACTGGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-772s1c1
Sequence:CCGGGAACCATGTGATGGTACGTGTCTCGAGACACGTACCATCACATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-2546s1c1
Sequence:CCGGGAGGAAGGAAAGGAGGAGAAACTCGAGTTTCTCCTCCTTTCCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-1820s1c1
Sequence:CCGGCAAGCCATCTACTGTAGCCTTCTCGAGAAGGCTACAGTAGATGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139285
GAS2L2 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 2 like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139285.2-988s21c1
Sequence:CCGGTGTGGACTGGAAGACATATACCTCGAGGTATATGTCTTCCAGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139285.2-2615s21c1
Sequence:CCGGCAACCTCACTGGCTTAATCAACTCGAGTTGATTAAGCCAGTGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139285.2-2787s21c1
Sequence:CCGGGGAGTGGGTCAGAAGACAAATCTCGAGATTTGTCTTCTGACCCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139285.2-690s21c1
Sequence:CCGGTGCAGTTCTCCATGGTCAAAGCTCGAGCTTTGACCATGGAGAACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-1365s1c1
Sequence:CCGGCCACCAAAGGGATATCAGCAACTCGAGTTGCTGATATCCCTTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-376s1c1
Sequence:CCGGCTTCATCCAGTGGTGTCGAAACTCGAGTTTCGACACCACTGGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-772s1c1
Sequence:CCGGGAACCATGTGATGGTACGTGTCTCGAGACACGTACCATCACATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-2546s1c1
Sequence:CCGGGAGGAAGGAAAGGAGGAGAAACTCGAGTTTCTCCTCCTTTCCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-1820s1c1
Sequence:CCGGCAAGCCATCTACTGTAGCCTTCTCGAGAAGGCTACAGTAGATGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139285
GAS2L2 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 2 like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139285.2-988s21c1
Sequence:CCGGTGTGGACTGGAAGACATATACCTCGAGGTATATGTCTTCCAGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139285.2-2615s21c1
Sequence:CCGGCAACCTCACTGGCTTAATCAACTCGAGTTGATTAAGCCAGTGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139285.2-2787s21c1
Sequence:CCGGGGAGTGGGTCAGAAGACAAATCTCGAGATTTGTCTTCTGACCCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139285.2-690s21c1
Sequence:CCGGTGCAGTTCTCCATGGTCAAAGCTCGAGCTTTGACCATGGAGAACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-1365s1c1
Sequence:CCGGCCACCAAAGGGATATCAGCAACTCGAGTTGCTGATATCCCTTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-376s1c1
Sequence:CCGGCTTCATCCAGTGGTGTCGAAACTCGAGTTTCGACACCACTGGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-772s1c1
Sequence:CCGGGAACCATGTGATGGTACGTGTCTCGAGACACGTACCATCACATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-2546s1c1
Sequence:CCGGGAGGAAGGAAAGGAGGAGAAACTCGAGTTTCTCCTCCTTTCCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139285.1-1820s1c1
Sequence:CCGGCAAGCCATCTACTGTAGCCTTCTCGAGAAGGCTACAGTAGATGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013759
GAS2L2 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 2 like 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013759.1-811s1c1
Sequence:CCGGCTGGGCCATTATCTGGATAAACTCGAGTTTATCCAGATAATGGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013759.1-357s1c1
Sequence:CCGGCAGGGACAACATCTCCAACTTCTCGAGAAGTTGGAGATGTTGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013759.1-2271s1c1
Sequence:CCGGCCAGAAGATCCCATCCATTTACTCGAGTAAATGGATGGGATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013759.1-1786s1c1
Sequence:CCGGGATAACCTTAAAGAGGAGGTTCTCGAGAACCTCCTCTTTAAGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013759.1-690s1c1
Sequence:CCGGGCAATTCTCCATGGTCAAGATCTCGAGATCTTGACCATGGAGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013759.1-2460s1c1
Sequence:CCGGCCAGGTGAATGGAACAGGTAACTCGAGTTACCTGTTCCATTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013759.1-1974s1c1
Sequence:CCGGCCTCCTTAAAGTGGATCTGAACTCGAGTTCAGATCCACTTTAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013759.1-738s1c1
Sequence:CCGGCTCCAACACTCTCATCTTCATCTCGAGATGAAGATGAGAGTGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013759
GAS2L2 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 2 like 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013759.1-811s1c1
Sequence:CCGGCTGGGCCATTATCTGGATAAACTCGAGTTTATCCAGATAATGGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013759.1-357s1c1
Sequence:CCGGCAGGGACAACATCTCCAACTTCTCGAGAAGTTGGAGATGTTGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013759.1-2271s1c1
Sequence:CCGGCCAGAAGATCCCATCCATTTACTCGAGTAAATGGATGGGATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013759.1-1786s1c1
Sequence:CCGGGATAACCTTAAAGAGGAGGTTCTCGAGAACCTCCTCTTTAAGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013759.1-690s1c1
Sequence:CCGGGCAATTCTCCATGGTCAAGATCTCGAGATCTTGACCATGGAGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013759.1-2460s1c1
Sequence:CCGGCCAGGTGAATGGAACAGGTAACTCGAGTTACCTGTTCCATTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013759.1-1974s1c1
Sequence:CCGGCCTCCTTAAAGTGGATCTGAACTCGAGTTCAGATCCACTTTAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013759.1-738s1c1
Sequence:CCGGCTCCAACACTCTCATCTTCATCTCGAGATGAAGATGAGAGTGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013759
GAS2L2 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 2 like 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013759.1-811s1c1
Sequence:CCGGCTGGGCCATTATCTGGATAAACTCGAGTTTATCCAGATAATGGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013759.1-357s1c1
Sequence:CCGGCAGGGACAACATCTCCAACTTCTCGAGAAGTTGGAGATGTTGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013759.1-2271s1c1
Sequence:CCGGCCAGAAGATCCCATCCATTTACTCGAGTAAATGGATGGGATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013759.1-1786s1c1
Sequence:CCGGGATAACCTTAAAGAGGAGGTTCTCGAGAACCTCCTCTTTAAGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013759.1-690s1c1
Sequence:CCGGGCAATTCTCCATGGTCAAGATCTCGAGATCTTGACCATGGAGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013759.1-2460s1c1
Sequence:CCGGCCAGGTGAATGGAACAGGTAACTCGAGTTACCTGTTCCATTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013759.1-1974s1c1
Sequence:CCGGCCTCCTTAAAGTGGATCTGAACTCGAGTTCAGATCCACTTTAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013759.1-738s1c1
Sequence:CCGGCTCCAACACTCTCATCTTCATCTCGAGATGAAGATGAGAGTGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks