EMAIL THIS PAGE TO A FRIEND

GAS2L3

growth arrest-specific 2 like 3

58 Gene Product Result for
Synonyms: G2L3
UniProtKB ID: Q86XJ1, B2RCN2
Gene ID:
Mouse(237436) growth arrest-specific 2 like 3
Rat(680280) growth arrest-specific 2 like 3
Zebrafish(566151) growth arrest-specific 2 like 3
cow(782903) growth arrest-specific 2 like 3
Horse(100052872) growth arrest-specific 2 like 3
domestic cat(101097568) growth arrest-specific 2 like 3
dog(482624) growth arrest-specific 2 like 3
chicken(417931) growth arrest-specific 2 like 3
naked mole-rat(101713675) growth arrest-specific 2 like 3
domestic guinea pig(100733816) growth arrest-specific 2 like 3
sheep(101105994) growth arrest-specific 2 like 3
Domestic Rabbit(100339304) growth arrest-specific 2 like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174942 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_137276 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_137276 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_137276 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174942 Rosetta Predictions human pricing
XM_001056437 Rosetta Predictions rat pricing
NM_001033331 Rosetta Predictions mouse pricing
NM_001079876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152119 predicted 1661
2 SASI_Hs01_00152120 predicted 440
3 SASI_Hs01_00152121 predicted 382
4 SASI_Hs02_00368885 predicted 862
5 SASI_Hs01_00152122 predicted 599
6 SASI_Hs01_00152123 predicted 847
7 SASI_Hs01_00152124 predicted 367
8 SASI_Hs01_00152125 predicted 719
9 SASI_Hs01_00152126 predicted 1182
10 SASI_Hs01_00152127 predicted 1320
11 SASI_Hs01_00152128 predicted 1752
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283278 predicted 407
2 SASI_Rn02_00283279 predicted 1549
3 SASI_Rn02_00283280 predicted 1355
4 SASI_Rn02_00283281 predicted 720
5 SASI_Rn02_00283282 predicted 1086
6 SASI_Rn02_00283283 predicted 1595
7 SASI_Rn02_00283284 predicted 1440
8 SASI_Rn02_00283285 predicted 1173
9 SASI_Rn02_00283286 predicted 1051
10 SASI_Rn02_00283287 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110827 predicted 1162
2 SASI_Mm01_00110828 predicted 1651
3 SASI_Mm01_00110829 predicted 1272
4 SASI_Mm01_00110830 predicted 2393
5 SASI_Mm01_00110831 predicted 2430
6 SASI_Mm02_00288576 predicted 1428
7 SASI_Mm01_00110832 predicted 949
8 SASI_Mm02_00288577 predicted 1214
9 SASI_Mm01_00110836 predicted 709
10 SASI_Mm02_00288578 predicted 554
11 SASI_Mm01_00110833 predicted 742
12 SASI_Mm01_00110834 predicted 491
13 SASI_Mm01_00110835 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293182 predicted 1168
2 SASI_Mm02_00293183 predicted 1657
3 SASI_Mm02_00293184 predicted 1271
4 SASI_Mm02_00293185 predicted 2401
5 SASI_Mm02_00293186 predicted 2438
6 SASI_Mm02_00293187 predicted 1439
7 SASI_Mm02_00293188 predicted 952
8 SASI_Mm02_00293189 predicted 1212
9 SASI_Mm02_00293190 predicted 717
10 SASI_Mm02_00293191 predicted 554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174942
VALIDATED
GAS2L3 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 2 like 3
Human
22 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174942.1-1228s1c1
Sequence:CCGGCGTGCCAGTTAGTATTCCAAACTCGAGTTTGGAATACTAACTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174942.1-1330s1c1
Sequence:CCGGAGTCCGTTCTAAATTGCCAAACTCGAGTTTGGCAATTTAGAACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174942.1-1227s1c1
Sequence:CCGGGCGTGCCAGTTAGTATTCCAACTCGAGTTGGAATACTAACTGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-649s1c1
Sequence:CCGGCCTCTTTGAATCTGAAGGTTTCTCGAGAAACCTTCAGATTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1320s1c1
Sequence:CCGGGCTCTATGTCAGTCCGTTCTACTCGAGTAGAACGGACTGACATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1320s1c2
Sequence:CCGGGCTCTATGTCAGTCCGTTCTACTCGAGTAGAACGGACTGACATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174942.1-388s1c1
Sequence:CCGGGTCAATCTGGTTATCTGGTTTCTCGAGAAACCAGATAACCAGATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1023s1c1
Sequence:CCGGGCTGGGATACTCTTCAAGGATCTCGAGATCCTTGAAGAGTATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174942.1-314s1c1
Sequence:CCGGGCTAATGTTTGTCAGTACGATCTCGAGATCGTACTGACAAACATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-552s1c1
Sequence:CCGGCCTGTAAGAAAGATGCTGCATCTCGAGATGCAGCATCTTTCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1882s1c1
Sequence:CCGGGAAACTTAAATCGGCCTTGAACTCGAGTTCAAGGCCGATTTAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1445s1c1
Sequence:CCGGGCTTCATTAAATCCAGTAGGTCTCGAGACCTACTGGATTTAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174942.1-1725s1c1
Sequence:CCGGCCAAGCTGCCTAAAGCAAATACTCGAGTATTTGCTTTAGGCAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-300s21c1
Sequence:CCGGACGGACCAGGATTGGCTAATGCTCGAGCATTAGCCAATCCTGGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-1743s21c1
Sequence:CCGGATATACCTGTAAGACCTAAACCTCGAGGTTTAGGTCTTACAGGTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-1126s21c1
Sequence:CCGGTAATGAAAGTGTACCTGATTCCTCGAGGAATCAGGTACACTTTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-1688s21c1
Sequence:CCGCCACTTAGCTGCACATTCAAATCTCGAGATTTGAATGTGCAGCTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-860s21c1
Sequence:CCGGGAGCTACATGAAGCTGTTAAACTCGAGTTTAACAGCTTCATGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-1177s21c1
Sequence:CCGGGAATCCTTTGTCAGCAGTTAACTCGAGTTAACTGCTGACAAAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-390s21c1
Sequence:CCGGCAATCTGGTTATCTGGTTTATCTCGAGATAAACCAGATAACCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-902s21c1
Sequence:CCGGTGTAGTTGTTCTCATCGATTTCTCGAGAAATCGATGAGAACAACTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-448s21c1
Sequence:CCGGACTTGATAATGGAGTACTATTCTCGAGAATAGTACTCCATTATCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174942
VALIDATED
GAS2L3 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 2 like 3
Human
22 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174942.1-1228s1c1
Sequence:CCGGCGTGCCAGTTAGTATTCCAAACTCGAGTTTGGAATACTAACTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174942.1-1330s1c1
Sequence:CCGGAGTCCGTTCTAAATTGCCAAACTCGAGTTTGGCAATTTAGAACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174942.1-1227s1c1
Sequence:CCGGGCGTGCCAGTTAGTATTCCAACTCGAGTTGGAATACTAACTGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-649s1c1
Sequence:CCGGCCTCTTTGAATCTGAAGGTTTCTCGAGAAACCTTCAGATTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1320s1c1
Sequence:CCGGGCTCTATGTCAGTCCGTTCTACTCGAGTAGAACGGACTGACATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1320s1c2
Sequence:CCGGGCTCTATGTCAGTCCGTTCTACTCGAGTAGAACGGACTGACATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174942.1-388s1c1
Sequence:CCGGGTCAATCTGGTTATCTGGTTTCTCGAGAAACCAGATAACCAGATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1023s1c1
Sequence:CCGGGCTGGGATACTCTTCAAGGATCTCGAGATCCTTGAAGAGTATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174942.1-314s1c1
Sequence:CCGGGCTAATGTTTGTCAGTACGATCTCGAGATCGTACTGACAAACATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-552s1c1
Sequence:CCGGCCTGTAAGAAAGATGCTGCATCTCGAGATGCAGCATCTTTCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1882s1c1
Sequence:CCGGGAAACTTAAATCGGCCTTGAACTCGAGTTCAAGGCCGATTTAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1445s1c1
Sequence:CCGGGCTTCATTAAATCCAGTAGGTCTCGAGACCTACTGGATTTAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174942.1-1725s1c1
Sequence:CCGGCCAAGCTGCCTAAAGCAAATACTCGAGTATTTGCTTTAGGCAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-300s21c1
Sequence:CCGGACGGACCAGGATTGGCTAATGCTCGAGCATTAGCCAATCCTGGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-1743s21c1
Sequence:CCGGATATACCTGTAAGACCTAAACCTCGAGGTTTAGGTCTTACAGGTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-1126s21c1
Sequence:CCGGTAATGAAAGTGTACCTGATTCCTCGAGGAATCAGGTACACTTTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-1688s21c1
Sequence:CCGCCACTTAGCTGCACATTCAAATCTCGAGATTTGAATGTGCAGCTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-860s21c1
Sequence:CCGGGAGCTACATGAAGCTGTTAAACTCGAGTTTAACAGCTTCATGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-1177s21c1
Sequence:CCGGGAATCCTTTGTCAGCAGTTAACTCGAGTTAACTGCTGACAAAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-390s21c1
Sequence:CCGGCAATCTGGTTATCTGGTTTATCTCGAGATAAACCAGATAACCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-902s21c1
Sequence:CCGGTGTAGTTGTTCTCATCGATTTCTCGAGAAATCGATGAGAACAACTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-448s21c1
Sequence:CCGGACTTGATAATGGAGTACTATTCTCGAGAATAGTACTCCATTATCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174942
VALIDATED
GAS2L3 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 2 like 3
Human
22 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174942.1-1228s1c1
Sequence:CCGGCGTGCCAGTTAGTATTCCAAACTCGAGTTTGGAATACTAACTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174942.1-1330s1c1
Sequence:CCGGAGTCCGTTCTAAATTGCCAAACTCGAGTTTGGCAATTTAGAACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174942.1-1227s1c1
Sequence:CCGGGCGTGCCAGTTAGTATTCCAACTCGAGTTGGAATACTAACTGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-649s1c1
Sequence:CCGGCCTCTTTGAATCTGAAGGTTTCTCGAGAAACCTTCAGATTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1320s1c1
Sequence:CCGGGCTCTATGTCAGTCCGTTCTACTCGAGTAGAACGGACTGACATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1320s1c2
Sequence:CCGGGCTCTATGTCAGTCCGTTCTACTCGAGTAGAACGGACTGACATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174942.1-388s1c1
Sequence:CCGGGTCAATCTGGTTATCTGGTTTCTCGAGAAACCAGATAACCAGATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1023s1c1
Sequence:CCGGGCTGGGATACTCTTCAAGGATCTCGAGATCCTTGAAGAGTATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174942.1-314s1c1
Sequence:CCGGGCTAATGTTTGTCAGTACGATCTCGAGATCGTACTGACAAACATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-552s1c1
Sequence:CCGGCCTGTAAGAAAGATGCTGCATCTCGAGATGCAGCATCTTTCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1882s1c1
Sequence:CCGGGAAACTTAAATCGGCCTTGAACTCGAGTTCAAGGCCGATTTAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174942.1-1445s1c1
Sequence:CCGGGCTTCATTAAATCCAGTAGGTCTCGAGACCTACTGGATTTAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174942.1-1725s1c1
Sequence:CCGGCCAAGCTGCCTAAAGCAAATACTCGAGTATTTGCTTTAGGCAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-300s21c1
Sequence:CCGGACGGACCAGGATTGGCTAATGCTCGAGCATTAGCCAATCCTGGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-1743s21c1
Sequence:CCGGATATACCTGTAAGACCTAAACCTCGAGGTTTAGGTCTTACAGGTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-1126s21c1
Sequence:CCGGTAATGAAAGTGTACCTGATTCCTCGAGGAATCAGGTACACTTTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-1688s21c1
Sequence:CCGCCACTTAGCTGCACATTCAAATCTCGAGATTTGAATGTGCAGCTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-860s21c1
Sequence:CCGGGAGCTACATGAAGCTGTTAAACTCGAGTTTAACAGCTTCATGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-1177s21c1
Sequence:CCGGGAATCCTTTGTCAGCAGTTAACTCGAGTTAACTGCTGACAAAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-390s21c1
Sequence:CCGGCAATCTGGTTATCTGGTTTATCTCGAGATAAACCAGATAACCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-902s21c1
Sequence:CCGGTGTAGTTGTTCTCATCGATTTCTCGAGAAATCGATGAGAACAACTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174942.1-448s21c1
Sequence:CCGGACTTGATAATGGAGTACTATTCTCGAGAATAGTACTCCATTATCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_137276
GAS2L3 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 2 like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-1674s1c1
Sequence:CCGGGCCTCCAGAAATGAACCCTTTCTCGAGAAAGGGTTCATTTCTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-1158s1c1
Sequence:CCGGCCTCTTTGAGTCGGAAGGTTTCTCGAGAAACCTTCCGACTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-1634s1c1
Sequence:CCGGCTAATGAAAGCGTGCCAGATTCTCGAGAATCTGGCACGCTTTCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-2429s1c1
Sequence:CCGGCGAAAGGTAAGAATACAGTTTCTCGAGAAACTGTATTCTTACCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-957s1c1
Sequence:CCGGGCTCGATAATGGAGTGCTGTTCTCGAGAACAGCACTCCATTATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_137276
GAS2L3 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 2 like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-1674s1c1
Sequence:CCGGGCCTCCAGAAATGAACCCTTTCTCGAGAAAGGGTTCATTTCTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-1158s1c1
Sequence:CCGGCCTCTTTGAGTCGGAAGGTTTCTCGAGAAACCTTCCGACTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-1634s1c1
Sequence:CCGGCTAATGAAAGCGTGCCAGATTCTCGAGAATCTGGCACGCTTTCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-2429s1c1
Sequence:CCGGCGAAAGGTAAGAATACAGTTTCTCGAGAAACTGTATTCTTACCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-957s1c1
Sequence:CCGGGCTCGATAATGGAGTGCTGTTCTCGAGAACAGCACTCCATTATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_137276
GAS2L3 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 2 like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-1674s1c1
Sequence:CCGGGCCTCCAGAAATGAACCCTTTCTCGAGAAAGGGTTCATTTCTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-1158s1c1
Sequence:CCGGCCTCTTTGAGTCGGAAGGTTTCTCGAGAAACCTTCCGACTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-1634s1c1
Sequence:CCGGCTAATGAAAGCGTGCCAGATTCTCGAGAATCTGGCACGCTTTCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-2429s1c1
Sequence:CCGGCGAAAGGTAAGAATACAGTTTCTCGAGAAACTGTATTCTTACCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137276.6-957s1c1
Sequence:CCGGGCTCGATAATGGAGTGCTGTTCTCGAGAACAGCACTCCATTATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks