EMAIL THIS PAGE TO A FRIEND

GAS6

growth arrest-specific 6

63 Gene Product Result for
Synonyms: AXLLG AXSF
UniProtKB ID: Q14393, B3KRQ7, B3KVL4, E9PBL7, Q6IMN1, Q7Z7N3
Gene ID:
Human(2621) Summary: This gene product is a gamma-carboxyglutamic acid (Gla)-containing protein thought to be involved in the stimulation of cell proliferation, and may play a role in thrombosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Mouse(14456) growth arrest specific 6
Rat(58935) growth arrest specific 6
Zebrafish(335830) growth arrest-specific 6
cow(504526) growth arrest-specific 6
Horse(100069217) growth arrest-specific 6
domestic cat(101099014) growth arrest-specific 6
chicken(418737) growth arrest-specific 6
dog(607745) growth arrest-specific 6
sheep(101120928) growth arrest-specific 6
domestic guinea pig(100728744) growth arrest-specific 6
naked mole-rat(101696321) growth arrest-specific 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000820 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019521 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019521 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019521 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000820 Rosetta Predictions human pricing
NM_057100 Rosetta Predictions rat pricing
NM_019521 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303295 predicted 1614
2 SASI_Hs01_00134486 predicted 1752
3 SASI_Hs01_00134488 predicted 1404
4 SASI_Hs01_00134489 predicted 1473
5 SASI_Hs01_00134490 predicted 794
6 SASI_Hs01_00134491 predicted 1095
7 SASI_Hs01_00134492 predicted 1679
8 SASI_Hs01_00134493 predicted 590
9 SASI_Hs01_00134494 predicted 2116
10 SASI_Hs02_00303296 predicted 2045
11 SASI_Hs01_00134487 predicted 1296
12 SASI_Hs01_00134495 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113902 predicted 890
2 SASI_Rn02_00267027 predicted 372
3 SASI_Rn01_00113903 predicted 408
4 SASI_Rn01_00113905 predicted 998
5 SASI_Rn01_00113907 predicted 1028
6 SASI_Rn01_00113908 predicted 1891
7 SASI_Rn02_00267028 predicted 879
8 SASI_Rn02_00267029 predicted 685
9 SASI_Rn02_00267030 predicted 493
10 SASI_Rn02_00267031 predicted 1075
11 SASI_Rn01_00113901 predicted 269
12 SASI_Rn01_00113904 predicted 2065
13 SASI_Rn01_00113906 predicted 2001
14 SASI_Rn01_00113909 predicted 243
15 SASI_Rn01_00113910 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177935 predicted 504
2 SASI_Mm01_00177936 predicted 440
3 SASI_Mm01_00177937 predicted 653
4 SASI_Mm01_00177938 predicted 437
5 SASI_Mm01_00177939 predicted 1953
6 SASI_Mm01_00177940 predicted 508
7 SASI_Mm01_00177941 predicted 1058
8 SASI_Mm01_00177942 predicted 1642
9 SASI_Mm01_00177943 predicted 953
10 SASI_Mm01_00177944 predicted 1233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000820
GAS6 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000820.2-1070s21c1
Sequence:CCGGTGATCCGACTGCGCTTCAAGACTCGAGTCTTGAAGCGCAGTCGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000820.2-448s21c1
Sequence:CCGGTATGGGTCTCCGTACACCAAACTCGAGTTTGGTGTACGGAGACCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000820.2-2449s21c1
Sequence:CCGGGCGCTTCTTTCTGACTCTAAACTCGAGTTTAGAGTCAGAAAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-1754s1c1
Sequence:CCGGAGACTATCACTCCACGAAGAACTCGAGTTCTTCGTGGAGTGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-1817s1c1
Sequence:CCGGCTTGGCCCTAATGGAGATCAACTCGAGTTGATCTCCATTAGGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-1271s1c1
Sequence:CCGGGCAGACAATCTCTGTTGAGGACTCGAGTCCTCAACAGAGATTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-547s1c1
Sequence:CCGGGCAACTTCTTCTGCCTGTGTACTCGAGTACACAGGCAGAAGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-401s1c1
Sequence:CCGGCCCAAGATACTTAGACTGCATCTCGAGATGCAGTCTAAGTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000820
GAS6 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000820.2-1070s21c1
Sequence:CCGGTGATCCGACTGCGCTTCAAGACTCGAGTCTTGAAGCGCAGTCGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000820.2-448s21c1
Sequence:CCGGTATGGGTCTCCGTACACCAAACTCGAGTTTGGTGTACGGAGACCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000820.2-2449s21c1
Sequence:CCGGGCGCTTCTTTCTGACTCTAAACTCGAGTTTAGAGTCAGAAAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-1754s1c1
Sequence:CCGGAGACTATCACTCCACGAAGAACTCGAGTTCTTCGTGGAGTGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-1817s1c1
Sequence:CCGGCTTGGCCCTAATGGAGATCAACTCGAGTTGATCTCCATTAGGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-1271s1c1
Sequence:CCGGGCAGACAATCTCTGTTGAGGACTCGAGTCCTCAACAGAGATTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-547s1c1
Sequence:CCGGGCAACTTCTTCTGCCTGTGTACTCGAGTACACAGGCAGAAGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-401s1c1
Sequence:CCGGCCCAAGATACTTAGACTGCATCTCGAGATGCAGTCTAAGTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000820
GAS6 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000820.2-1070s21c1
Sequence:CCGGTGATCCGACTGCGCTTCAAGACTCGAGTCTTGAAGCGCAGTCGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000820.2-448s21c1
Sequence:CCGGTATGGGTCTCCGTACACCAAACTCGAGTTTGGTGTACGGAGACCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000820.2-2449s21c1
Sequence:CCGGGCGCTTCTTTCTGACTCTAAACTCGAGTTTAGAGTCAGAAAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-1754s1c1
Sequence:CCGGAGACTATCACTCCACGAAGAACTCGAGTTCTTCGTGGAGTGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-1817s1c1
Sequence:CCGGCTTGGCCCTAATGGAGATCAACTCGAGTTGATCTCCATTAGGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-1271s1c1
Sequence:CCGGGCAGACAATCTCTGTTGAGGACTCGAGTCCTCAACAGAGATTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-547s1c1
Sequence:CCGGGCAACTTCTTCTGCCTGTGTACTCGAGTACACAGGCAGAAGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000820.1-401s1c1
Sequence:CCGGCCCAAGATACTTAGACTGCATCTCGAGATGCAGTCTAAGTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019521
VALIDATED
GAS6 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019521.2-1810s21c1
Sequence:CCGGCCACTCTACAAAGAAGCTCAACTCGAGTTGAGCTTCTTTGTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019521.2-441s21c1
Sequence:CCGGCGGAGTATTTCTATCCACGATCTCGAGATCGTGGATAGAAATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019521.2-2370s21c1
Sequence:CCGGCCTTGTAACATATCTGTACATCTCGAGATGTACAGATATGTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019521.2-1867s21c1
Sequence:CCGGCCTGGCACTGATGGAAATCAACTCGAGTTGATTTCCATCAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019521.2-1382s21c1
Sequence:CCGGGCTGTAATGAAGATCGCGGTACTCGAGTACCGCGATCTTCATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-1835s1c1
Sequence:CCGGCCTGGCACTGATGGAAATCAACTCGAGTTGATTTCCATCAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-1353s1c1
Sequence:CCGGGCTGTAATGAAGATCGCGGTACTCGAGTACCGCGATCTTCATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-412s1c1
Sequence:CCGGCGGAGTATTTCTATCCACGATCTCGAGATCGTGGATAGAAATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-1778s1c1
Sequence:CCGGCCACTCTACAAAGAAGCTCAACTCGAGTTGAGCTTCTTTGTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-2336s1c1
Sequence:CCGGCCTTGTAACATATCTGTACATCTCGAGATGTACAGATATGTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019521
VALIDATED
GAS6 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019521.2-1810s21c1
Sequence:CCGGCCACTCTACAAAGAAGCTCAACTCGAGTTGAGCTTCTTTGTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019521.2-441s21c1
Sequence:CCGGCGGAGTATTTCTATCCACGATCTCGAGATCGTGGATAGAAATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019521.2-2370s21c1
Sequence:CCGGCCTTGTAACATATCTGTACATCTCGAGATGTACAGATATGTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019521.2-1867s21c1
Sequence:CCGGCCTGGCACTGATGGAAATCAACTCGAGTTGATTTCCATCAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019521.2-1382s21c1
Sequence:CCGGGCTGTAATGAAGATCGCGGTACTCGAGTACCGCGATCTTCATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-1835s1c1
Sequence:CCGGCCTGGCACTGATGGAAATCAACTCGAGTTGATTTCCATCAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-1353s1c1
Sequence:CCGGGCTGTAATGAAGATCGCGGTACTCGAGTACCGCGATCTTCATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-412s1c1
Sequence:CCGGCGGAGTATTTCTATCCACGATCTCGAGATCGTGGATAGAAATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-1778s1c1
Sequence:CCGGCCACTCTACAAAGAAGCTCAACTCGAGTTGAGCTTCTTTGTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-2336s1c1
Sequence:CCGGCCTTGTAACATATCTGTACATCTCGAGATGTACAGATATGTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019521
VALIDATED
GAS6 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019521.2-1810s21c1
Sequence:CCGGCCACTCTACAAAGAAGCTCAACTCGAGTTGAGCTTCTTTGTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019521.2-441s21c1
Sequence:CCGGCGGAGTATTTCTATCCACGATCTCGAGATCGTGGATAGAAATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019521.2-2370s21c1
Sequence:CCGGCCTTGTAACATATCTGTACATCTCGAGATGTACAGATATGTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019521.2-1867s21c1
Sequence:CCGGCCTGGCACTGATGGAAATCAACTCGAGTTGATTTCCATCAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019521.2-1382s21c1
Sequence:CCGGGCTGTAATGAAGATCGCGGTACTCGAGTACCGCGATCTTCATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-1835s1c1
Sequence:CCGGCCTGGCACTGATGGAAATCAACTCGAGTTGATTTCCATCAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-1353s1c1
Sequence:CCGGGCTGTAATGAAGATCGCGGTACTCGAGTACCGCGATCTTCATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-412s1c1
Sequence:CCGGCGGAGTATTTCTATCCACGATCTCGAGATCGTGGATAGAAATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-1778s1c1
Sequence:CCGGCCACTCTACAAAGAAGCTCAACTCGAGTTGAGCTTCTTTGTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019521.1-2336s1c1
Sequence:CCGGCCTTGTAACATATCTGTACATCTCGAGATGTACAGATATGTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks