EMAIL THIS PAGE TO A FRIEND

GAS7

growth arrest-specific 7

165 Gene Product Result for
Synonyms: MLL/GAS7
UniProtKB ID: O60861, A8KAC2, B2RCK9, O43144, Q53Y77, Q7Z571
Gene ID:
Human(8522) Summary: Growth arrest-specific 7 is expressed primarily in terminally differentiated brain cells and predominantly in mature cerebellar Purkinje neurons. GAS7 plays a putative role in neuronal development. Several transcript variants encoding proteins which vary in the N-terminus have been described. [provided by RefSeq, Jul 2008]
Mouse(14457) growth arrest specific 7
Rat(85246) growth arrest specific 7
chicken(417305) growth arrest-specific 7
dog(608189) growth arrest-specific 7
Horse(100073080) growth arrest-specific 7
cow(614517) growth arrest-specific 7
domestic cat(101084661) growth arrest-specific 7
naked mole-rat(101726568) growth arrest-specific 7
domestic guinea pig(100728403) growth arrest-specific 7
sheep(101111467) growth arrest-specific 7
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108459 Anti-GAS7 IgG fraction of antiserum horse, rabbit, mouse, bovine, guinea pig, canine, rat, human
immunohistochemistry, western blot pricing
AV30004 Anti-GAS7 (AB1) antibody produced in rabbit IgG fraction of antiserum horse, guinea pig, canine, rat, rabbit, human, bovine, mouse
immunohistochemistry, western blot pricing
AV47759 Anti-GAS7 (AB2) antibody produced in rabbit IgG fraction of antiserum guinea pig, canine, mouse, horse, rabbit, human, rat, bovine
western blot pricing
GW22099F Anti-GAS7 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
SAB1406679 Anti-GAS7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution rat, human
western blot pricing
SAB2100896 Anti-GAS7 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA004838 Anti-GAS7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA064678 Anti-GAS7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1402988 Monoclonal Anti-GAS7 antibody produced in mouse clone 1H3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB4100160 Monoclonal Anti-GAS7 antibody produced in mouse clone GAS7-A141, culture supernatant human
western blot pricing
SAB4100161 Monoclonal Anti-GAS7 antibody produced in mouse clone GAS7-B141, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003644 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008088 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008088 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008088 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158541 MISSION® esiRNA esiRNA human GAS7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003644 Rosetta Predictions human pricing
NM_201432 Rosetta Predictions human pricing
NM_201433 Rosetta Predictions human pricing
NM_053484 Rosetta Predictions rat pricing
NM_001109657 Rosetta Predictions mouse pricing
NM_008088 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062785 predicted 431
2 SASI_Hs01_00062786 predicted 1626
3 SASI_Hs01_00062789 predicted 1554
4 SASI_Hs01_00062790 predicted 584
5 SASI_Hs01_00062791 predicted 756
6 SASI_Hs02_00336003 predicted 1614
7 SASI_Hs01_00062792 predicted 572
8 SASI_Hs01_00062793 predicted 1594
9 SASI_Hs01_00062794 predicted 446
10 SASI_Hs02_00336004 predicted 1423
11 SASI_Hs01_00062787 predicted 1534
12 SASI_Hs01_00062788 predicted 1574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097358 predicted 837
2 SASI_Hs01_00097359 predicted 2038
3 SASI_Hs01_00097362 predicted 1964
4 SASI_Hs01_00097363 predicted 998
5 SASI_Hs01_00097364 predicted 1163
6 SASI_Hs02_00372966 predicted 2017
7 SASI_Hs01_00097365 predicted 984
8 SASI_Hs01_00097366 predicted 1997
9 SASI_Hs01_00097367 predicted 853
10 SASI_Hs02_00372967 predicted 1833
11 SASI_Hs01_00097360 predicted 1939
12 SASI_Hs01_00097361 predicted 1976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218309 predicted 869
2 SASI_Hs01_00218310 predicted 2067
3 SASI_Hs01_00218313 predicted 1996
4 SASI_Hs01_00218314 predicted 1024
5 SASI_Hs01_00218315 predicted 1198
6 SASI_Hs02_00372968 predicted 2052
7 SASI_Hs01_00218316 predicted 1009
8 SASI_Hs01_00218317 predicted 2029
9 SASI_Hs01_00218318 predicted 881
10 SASI_Hs02_00372969 predicted 1866
11 SASI_Hs01_00218311 predicted 1971
12 SASI_Hs01_00218312 predicted 2013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053484 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076742 predicted 709
2 SASI_Rn01_00076743 predicted 632
3 SASI_Rn01_00076744 predicted 483
4 SASI_Rn01_00076746 predicted 654
5 SASI_Rn01_00076747 predicted 375
6 SASI_Rn01_00076748 predicted 1203
7 SASI_Rn01_00076749 predicted 501
8 SASI_Rn01_00076750 predicted 260
9 SASI_Rn01_00076751 predicted 759
10 SASI_Rn02_00266083 predicted 1161
11 SASI_Rn01_00076745 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304094 predicted 830
2 SASI_Mm02_00304095 predicted 1348
3 SASI_Mm02_00304096 predicted 1610
4 SASI_Mm02_00304097 predicted 848
5 SASI_Mm02_00304098 predicted 1168
6 SASI_Mm02_00304099 predicted 945
7 SASI_Mm02_00304100 predicted 619
8 SASI_Mm02_00304101 predicted 1490
9 SASI_Mm02_00304102 predicted 1685
10 SASI_Mm02_00304103 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162547 predicted 668
2 SASI_Mm01_00162548 predicted 1189
3 SASI_Mm01_00162549 predicted 1450
4 SASI_Mm01_00162550 predicted 688
5 SASI_Mm01_00162551 predicted 1008
6 SASI_Mm01_00162552 predicted 788
7 SASI_Mm01_00162554 predicted 457
8 SASI_Mm01_00162555 predicted 1332
9 SASI_Mm02_00313105 predicted 1524
10 SASI_Mm01_00162556 predicted 780
11 SASI_Mm01_00162553 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003644
VALIDATED
GAS7 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000454956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003644.2-326s21c1
Sequence:CCGGCGACTACTTCTGGGCTGATAACTCGAGTTATCAGCCCAGAAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003644.2-7542s1c1
Sequence:CCGGGCTGCCTAGATCAGTAAATAACTCGAGTTATTTACTGATCTAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003644.2-412s1c1
Sequence:CCGGGCAAACAAATGCAGAAGGAAACTCGAGTTTCCTTCTGCATTTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003644.2-641s1c1
Sequence:CCGGCTTCCGTGAGAACTTCAAGAACTCGAGTTCTTGAAGTTCTCACGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_003644.2-900s1c1
Sequence:CCGGGCCCAGTCCAAATGGTTTGAACTCGAGTTCAAACCATTTGGACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003644.2-1010s1c1
Sequence:CCGGGCGGCATGAAACAGACATGTTCTCGAGAACATGTCTGTTTCATGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003644.2-670s21c1
Sequence:CCGGAGAAGTGCGACCACCACATTGCTCGAGCAATGTGGTGGTCGCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003644
VALIDATED
GAS7 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000454956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003644.2-326s21c1
Sequence:CCGGCGACTACTTCTGGGCTGATAACTCGAGTTATCAGCCCAGAAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003644.2-7542s1c1
Sequence:CCGGGCTGCCTAGATCAGTAAATAACTCGAGTTATTTACTGATCTAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003644.2-412s1c1
Sequence:CCGGGCAAACAAATGCAGAAGGAAACTCGAGTTTCCTTCTGCATTTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003644.2-641s1c1
Sequence:CCGGCTTCCGTGAGAACTTCAAGAACTCGAGTTCTTGAAGTTCTCACGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_003644.2-900s1c1
Sequence:CCGGGCCCAGTCCAAATGGTTTGAACTCGAGTTCAAACCATTTGGACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003644.2-1010s1c1
Sequence:CCGGGCGGCATGAAACAGACATGTTCTCGAGAACATGTCTGTTTCATGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003644.2-670s21c1
Sequence:CCGGAGAAGTGCGACCACCACATTGCTCGAGCAATGTGGTGGTCGCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003644
VALIDATED
GAS7 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000454956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003644.2-326s21c1
Sequence:CCGGCGACTACTTCTGGGCTGATAACTCGAGTTATCAGCCCAGAAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003644.2-7542s1c1
Sequence:CCGGGCTGCCTAGATCAGTAAATAACTCGAGTTATTTACTGATCTAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003644.2-412s1c1
Sequence:CCGGGCAAACAAATGCAGAAGGAAACTCGAGTTTCCTTCTGCATTTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003644.2-641s1c1
Sequence:CCGGCTTCCGTGAGAACTTCAAGAACTCGAGTTCTTGAAGTTCTCACGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_003644.2-900s1c1
Sequence:CCGGGCCCAGTCCAAATGGTTTGAACTCGAGTTCAAACCATTTGGACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003644.2-1010s1c1
Sequence:CCGGGCGGCATGAAACAGACATGTTCTCGAGAACATGTCTGTTTCATGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003644.2-670s21c1
Sequence:CCGGAGAAGTGCGACCACCACATTGCTCGAGCAATGTGGTGGTCGCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008088
GAS7 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008088.1-1552s1c1
Sequence:CCGGCCCAGTATTTCCAGGCCATAACTCGAGTTATGGCCTGGAAATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008088.1-240s1c1
Sequence:CCGGGCCGTTACTATGTCAACACGACTCGAGTCGTGTTGACATAGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008088.1-243s1c1
Sequence:CCGGGTTACTATGTCAACACGACTACTCGAGTAGTCGTGTTGACATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008088.1-1211s1c1
Sequence:CCGGGTGGAAATGATCCGACAACATCTCGAGATGTTGTCGGATCATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008088.1-1033s1c1
Sequence:CCGGGCTGGAGATCAAGTTGAGCAACTCGAGTTGCTCAACTTGATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008088
GAS7 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008088.1-1552s1c1
Sequence:CCGGCCCAGTATTTCCAGGCCATAACTCGAGTTATGGCCTGGAAATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008088.1-240s1c1
Sequence:CCGGGCCGTTACTATGTCAACACGACTCGAGTCGTGTTGACATAGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008088.1-243s1c1
Sequence:CCGGGTTACTATGTCAACACGACTACTCGAGTAGTCGTGTTGACATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008088.1-1211s1c1
Sequence:CCGGGTGGAAATGATCCGACAACATCTCGAGATGTTGTCGGATCATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008088.1-1033s1c1
Sequence:CCGGGCTGGAGATCAAGTTGAGCAACTCGAGTTGCTCAACTTGATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008088
GAS7 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008088.1-1552s1c1
Sequence:CCGGCCCAGTATTTCCAGGCCATAACTCGAGTTATGGCCTGGAAATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008088.1-240s1c1
Sequence:CCGGGCCGTTACTATGTCAACACGACTCGAGTCGTGTTGACATAGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008088.1-243s1c1
Sequence:CCGGGTTACTATGTCAACACGACTACTCGAGTAGTCGTGTTGACATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008088.1-1211s1c1
Sequence:CCGGGTGGAAATGATCCGACAACATCTCGAGATGTTGTCGGATCATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008088.1-1033s1c1
Sequence:CCGGGCTGGAGATCAAGTTGAGCAACTCGAGTTGCTCAACTTGATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks