EMAIL THIS PAGE TO A FRIEND

GAS8

growth arrest-specific 8

81 Gene Product Result for
Synonyms: GAS11
UniProtKB ID: O95995, B2RCT1, Q2M234
Gene ID:
Human(2622) Summary: This gene includes 11 exons spanning 25 kb and maps to a region of chromosome 16 that is sometimes deleted in breast and prostrate cancer. The second intron contains an apparently intronless gene, C16orf3, that is transcribed in the opposite orientation. This gene is a putative tumor suppressor gene. [provided by RefSeq, Jul 2008]
Mouse(104346) growth arrest specific 8
Rat(361438) growth arrest specific 8
Zebrafish(323260) growth arrest-specific 8
fruit fly(31321) Growth arrest specific protein 8
chicken(415858) growth arrest-specific 8
dog(608663) growth arrest-specific 8
Horse(100052980) growth arrest-specific 8
cow(504318) growth arrest-specific 8
domestic cat(101084502) growth arrest-specific 8
sheep(101108770) growth arrest-specific 8
Domestic Rabbit(100342600) growth arrest-specific 8
domestic guinea pig(100734012) growth arrest-specific 8
naked mole-rat(101721681) growth arrest-specific 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001481 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001481 Rosetta Predictions human pricing
NR_023348 Rosetta Predictions human pricing
NM_001039030 Rosetta Predictions rat pricing
NM_018855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118298 predicted 546
2 SASI_Hs01_00118299 predicted 1197
3 SASI_Hs01_00118300 predicted 754
4 SASI_Hs01_00118301 predicted 1367
5 SASI_Hs01_00118302 predicted 493
6 SASI_Hs01_00118303 predicted 1574
7 SASI_Hs01_00118305 predicted 624
8 SASI_Hs01_00118306 predicted 488
9 SASI_Hs01_00118307 predicted 1335
10 SASI_Hs02_00331962 predicted 412
11 SASI_Hs01_00118304 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381732 predicted 656
2 SASI_Hs02_00381733 predicted 1313
3 SASI_Hs02_00381734 predicted 866
4 SASI_Hs02_00381735 predicted 1476
5 SASI_Hs02_00381736 predicted 609
6 SASI_Hs02_00381737 predicted 1690
7 SASI_Hs02_00381738 predicted 734
8 SASI_Hs02_00381739 predicted 594
9 SASI_Hs02_00381740 predicted 1444
10 SASI_Hs02_00381741 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059925 predicted 721
2 SASI_Rn01_00059926 predicted 1266
3 SASI_Rn01_00059927 predicted 550
4 SASI_Rn01_00059928 predicted 530
5 SASI_Rn01_00059929 predicted 333
6 SASI_Rn01_00059930 predicted 1322
7 SASI_Rn01_00059931 predicted 951
8 SASI_Rn02_00204783 predicted 562
9 SASI_Rn01_00059932 predicted 1232
10 SASI_Rn01_00059933 predicted 1214
11 SASI_Rn01_00059934 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048823 predicted 1318
2 SASI_Mm01_00048824 predicted 1361
3 SASI_Mm01_00048825 predicted 1026
4 SASI_Mm01_00048826 predicted 1399
5 SASI_Mm01_00048827 predicted 645
6 SASI_Mm02_00324210 predicted 814
7 SASI_Mm01_00048828 predicted 1327
8 SASI_Mm01_00048829 predicted 616
9 SASI_Mm02_00324211 predicted 256
10 SASI_Mm02_00324212 predicted 570
11 SASI_Mm01_00048830 predicted 1424
12 SASI_Mm01_00048831 predicted 1388
13 SASI_Mm01_00048832 predicted 1050
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001481
VALIDATED
GAS8 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 8
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-477s21c1
Sequence:CCGGGAGGGCACTGTAGTCATGAAGCTCGAGCTTCATGACTACAGTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-717s21c1
Sequence:CCGGGAACTCGACTTGCGGAGAAAGCTCGAGCTTTCTCCGCAAGTCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-1397s21c1
Sequence:CCGGCCAGGTCTGTAAGGCCCATAACTCGAGTTATGGGCCTTACAGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-1355s21c1
Sequence:CCGGGTCGAAGAACAGCACCATCAACTCGAGTTGATGGTGCTGTTCTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001481.2-1681s21c1
Sequence:CCGGCATGTTCTTGCCATCCTCTTTCTCGAGAAAGAGGATGGCAAGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-631s21c1
Sequence:CCGGAGATCACCAGGATGCGGAATGCTCGAGCATTCCGCATCCTGGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001481.1-1001s1c1
Sequence:CCGGGCAGAAACAGCTCGCAAACTACTCGAGTAGTTTGCGAGCTGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001481.1-814s1c1
Sequence:CCGGCCGACATTAAGAACTACTACACTCGAGTGTAGTAGTTCTTAATGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133948    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001481.1-3014s1c1
Sequence:CCGGCCTGTCTTTAGGAAATCACAACTCGAGTTGTGATTTCCTAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001481.1-669s1c1
Sequence:CCGGCGAGAAATTGAGGCCAAGTATCTCGAGATACTTGGCCTCAATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001481.1-998s1c1
Sequence:CCGGGATGCAGAAACAGCTCGCAAACTCGAGTTTGCGAGCTGTTTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001481.1-434s1c1
Sequence:CCGGCCTGCTATATGAGCACCAGAACTCGAGTTCTGGTGCTCATATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001481.1-833s1c1
Sequence:CCGGCAACGACATCACCCTCAACAACTCGAGTTGTTGAGGGTGATGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001481.1-1095s1c1
Sequence:CCGGCAGTGGGAGCATGAAGTGTTACTCGAGTAACACTTCATGCTCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001481.1-1193s1c1
Sequence:CCGGGCAGAAGACAGGGTTCAAGAACTCGAGTTCTTGAACCCTGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001481
VALIDATED
GAS8 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 8
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-477s21c1
Sequence:CCGGGAGGGCACTGTAGTCATGAAGCTCGAGCTTCATGACTACAGTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-717s21c1
Sequence:CCGGGAACTCGACTTGCGGAGAAAGCTCGAGCTTTCTCCGCAAGTCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-1397s21c1
Sequence:CCGGCCAGGTCTGTAAGGCCCATAACTCGAGTTATGGGCCTTACAGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-1355s21c1
Sequence:CCGGGTCGAAGAACAGCACCATCAACTCGAGTTGATGGTGCTGTTCTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001481.2-1681s21c1
Sequence:CCGGCATGTTCTTGCCATCCTCTTTCTCGAGAAAGAGGATGGCAAGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-631s21c1
Sequence:CCGGAGATCACCAGGATGCGGAATGCTCGAGCATTCCGCATCCTGGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001481.1-1001s1c1
Sequence:CCGGGCAGAAACAGCTCGCAAACTACTCGAGTAGTTTGCGAGCTGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001481.1-814s1c1
Sequence:CCGGCCGACATTAAGAACTACTACACTCGAGTGTAGTAGTTCTTAATGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133948    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001481.1-3014s1c1
Sequence:CCGGCCTGTCTTTAGGAAATCACAACTCGAGTTGTGATTTCCTAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001481.1-669s1c1
Sequence:CCGGCGAGAAATTGAGGCCAAGTATCTCGAGATACTTGGCCTCAATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001481.1-998s1c1
Sequence:CCGGGATGCAGAAACAGCTCGCAAACTCGAGTTTGCGAGCTGTTTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001481.1-434s1c1
Sequence:CCGGCCTGCTATATGAGCACCAGAACTCGAGTTCTGGTGCTCATATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001481.1-833s1c1
Sequence:CCGGCAACGACATCACCCTCAACAACTCGAGTTGTTGAGGGTGATGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001481.1-1095s1c1
Sequence:CCGGCAGTGGGAGCATGAAGTGTTACTCGAGTAACACTTCATGCTCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001481.1-1193s1c1
Sequence:CCGGGCAGAAGACAGGGTTCAAGAACTCGAGTTCTTGAACCCTGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001481
VALIDATED
GAS8 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 8
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-477s21c1
Sequence:CCGGGAGGGCACTGTAGTCATGAAGCTCGAGCTTCATGACTACAGTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-717s21c1
Sequence:CCGGGAACTCGACTTGCGGAGAAAGCTCGAGCTTTCTCCGCAAGTCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-1397s21c1
Sequence:CCGGCCAGGTCTGTAAGGCCCATAACTCGAGTTATGGGCCTTACAGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-1355s21c1
Sequence:CCGGGTCGAAGAACAGCACCATCAACTCGAGTTGATGGTGCTGTTCTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001481.2-1681s21c1
Sequence:CCGGCATGTTCTTGCCATCCTCTTTCTCGAGAAAGAGGATGGCAAGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001481.2-631s21c1
Sequence:CCGGAGATCACCAGGATGCGGAATGCTCGAGCATTCCGCATCCTGGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001481.1-1001s1c1
Sequence:CCGGGCAGAAACAGCTCGCAAACTACTCGAGTAGTTTGCGAGCTGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001481.1-814s1c1
Sequence:CCGGCCGACATTAAGAACTACTACACTCGAGTGTAGTAGTTCTTAATGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133948    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001481.1-3014s1c1
Sequence:CCGGCCTGTCTTTAGGAAATCACAACTCGAGTTGTGATTTCCTAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001481.1-669s1c1
Sequence:CCGGCGAGAAATTGAGGCCAAGTATCTCGAGATACTTGGCCTCAATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001481.1-998s1c1
Sequence:CCGGGATGCAGAAACAGCTCGCAAACTCGAGTTTGCGAGCTGTTTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001481.1-434s1c1
Sequence:CCGGCCTGCTATATGAGCACCAGAACTCGAGTTCTGGTGCTCATATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001481.1-833s1c1
Sequence:CCGGCAACGACATCACCCTCAACAACTCGAGTTGTTGAGGGTGATGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001481.1-1095s1c1
Sequence:CCGGCAGTGGGAGCATGAAGTGTTACTCGAGTAACACTTCATGCTCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001481.1-1193s1c1
Sequence:CCGGGCAGAAGACAGGGTTCAAGAACTCGAGTTCTTGAACCCTGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018855
VALIDATED
GAS8 MISSION shRNA Bacterial Glycerol Stock
growth arrest-specific 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018855.2-814s21c1
Sequence:CCGGCAAGAACTACTACAACGACATCTCGAGATGTCGTTGTAGTAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018855.2-884s21c1
Sequence:CCGGGACATGCGTAAGAAGGAGGAACTCGAGTTCCTCCTTCTTACGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018855.2-623s21c1
Sequence:CCGGGAGATCACCAAGATGCGAAATCTCGAGATTTCGCATCTTGGTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018855.2-1324s21c1
Sequence:CCGGCCGCAAACTTGAGGATGTTCTCTCGAGAGAACATCCTCAAGTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018855.1-905s1c1
Sequence:CCGGGACATGCGTAAGAAGGAGGAACTCGAGTTCCTCCTTCTTACGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018855.1-1345s1c1
Sequence:CCGGCCGCAAACTTGAGGATGTTCTCTCGAGAGAACATCCTCAAGTTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018855.1-835s1c1
Sequence:CCGGCAAGAACTACTACAACGACATCTCGAGATGTCGTTGTAGTAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018855.1-644s1c1
Sequence:CCGGGAGATCACCAAGATGCGAAATCTCGAGATTTCGCATCTTGGTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018855.1-649s1c1
Sequence:CCGGCACCAAGATGCGAAATGACTTCTCGAGAAGTCATTTCGCATCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018855
VALIDATED
GAS8 MISSION shRNA shRNA Plasmid DNA
growth arrest-specific 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018855.2-814s21c1
Sequence:CCGGCAAGAACTACTACAACGACATCTCGAGATGTCGTTGTAGTAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018855.2-884s21c1
Sequence:CCGGGACATGCGTAAGAAGGAGGAACTCGAGTTCCTCCTTCTTACGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018855.2-623s21c1
Sequence:CCGGGAGATCACCAAGATGCGAAATCTCGAGATTTCGCATCTTGGTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018855.2-1324s21c1
Sequence:CCGGCCGCAAACTTGAGGATGTTCTCTCGAGAGAACATCCTCAAGTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018855.1-905s1c1
Sequence:CCGGGACATGCGTAAGAAGGAGGAACTCGAGTTCCTCCTTCTTACGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018855.1-1345s1c1
Sequence:CCGGCCGCAAACTTGAGGATGTTCTCTCGAGAGAACATCCTCAAGTTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018855.1-835s1c1
Sequence:CCGGCAAGAACTACTACAACGACATCTCGAGATGTCGTTGTAGTAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018855.1-644s1c1
Sequence:CCGGGAGATCACCAAGATGCGAAATCTCGAGATTTCGCATCTTGGTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018855.1-649s1c1
Sequence:CCGGCACCAAGATGCGAAATGACTTCTCGAGAAGTCATTTCGCATCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018855
VALIDATED
GAS8 MISSION shRNA Lentiviral Transduction Particles
growth arrest-specific 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018855.2-814s21c1
Sequence:CCGGCAAGAACTACTACAACGACATCTCGAGATGTCGTTGTAGTAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018855.2-884s21c1
Sequence:CCGGGACATGCGTAAGAAGGAGGAACTCGAGTTCCTCCTTCTTACGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018855.2-623s21c1
Sequence:CCGGGAGATCACCAAGATGCGAAATCTCGAGATTTCGCATCTTGGTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018855.2-1324s21c1
Sequence:CCGGCCGCAAACTTGAGGATGTTCTCTCGAGAGAACATCCTCAAGTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018855.1-905s1c1
Sequence:CCGGGACATGCGTAAGAAGGAGGAACTCGAGTTCCTCCTTCTTACGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018855.1-1345s1c1
Sequence:CCGGCCGCAAACTTGAGGATGTTCTCTCGAGAGAACATCCTCAAGTTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018855.1-835s1c1
Sequence:CCGGCAAGAACTACTACAACGACATCTCGAGATGTCGTTGTAGTAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018855.1-644s1c1
Sequence:CCGGGAGATCACCAAGATGCGAAATCTCGAGATTTCGCATCTTGGTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018855.1-649s1c1
Sequence:CCGGCACCAAGATGCGAAATGACTTCTCGAGAAGTCATTTCGCATCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks