EMAIL THIS PAGE TO A FRIEND

GAST

gastrin

54 Gene Product Result for
Synonyms: GAS
UniProtKB ID: P01350, P78463, P78464
Gene ID:
Human(2520) Summary: Gastrin is a hormone whose main function is to stimulate secretion of hydrochloric acid by the gastric mucosa, which results in gastrin formation inhibition. This hormone also acts as a mitogenic factor for gastrointestinal epithelial cells. Gastrin has two biologically active peptide forms, G34 and G17. [provided by RefSeq, Jul 2008]
Mouse(14459) gastrin
Rat(25320) gastrin
dog(100685087) gastrin
cow(280800) gastrin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501048 Anti-Gastrin antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
G6047 Anti-GBP1 (46-60) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010257 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010257 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010257 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000805 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000805 Rosetta Predictions human pricing
NM_012849 Rosetta Predictions rat pricing
NM_010257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120062 predicted 36
2 SASI_Hs01_00120063 predicted 280
3 SASI_Hs01_00120064 predicted 319
4 SASI_Hs01_00120066 predicted 278
5 SASI_Hs01_00120067 predicted 332
6 SASI_Hs01_00120068 predicted 190
7 SASI_Hs01_00120069 predicted 42
8 SASI_Hs01_00120070 predicted 117
9 SASI_Hs01_00120071 predicted 118
10 SASI_Hs02_00303264 predicted 310
11 SASI_Hs01_00120065 predicted 42
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049646 predicted 201
2 SASI_Rn01_00049647 predicted 199
3 SASI_Rn01_00049648 predicted 98
4 SASI_Rn01_00049649 predicted 235
5 SASI_Rn01_00049650 predicted 81
6 SASI_Rn01_00049651 predicted 296
7 SASI_Rn01_00049652 predicted 347
8 SASI_Rn01_00049653 predicted 134
9 SASI_Rn01_00049654 predicted 77
10 SASI_Rn01_00049655 predicted 126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039668 predicted 199
2 SASI_Mm01_00039672 predicted 88
3 SASI_Mm01_00039673 predicted 60
4 SASI_Mm01_00039674 predicted 74
5 SASI_Mm01_00039676 predicted 348
6 SASI_Mm01_00039675 predicted 245
7 SASI_Mm02_00318153 predicted 158
8 SASI_Mm01_00039677 predicted 89
9 SASI_Mm02_00318154 predicted 169
10 SASI_Mm02_00318155 predicted 155
11 SASI_Mm01_00039669 predicted 238
12 SASI_Mm01_00039670 predicted 220
13 SASI_Mm01_00039671 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010257
GAST MISSION shRNA Bacterial Glycerol Stock
gastrin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010257.2-248s1c1
Sequence:CCGGGTCCTCAACACTTCATAGCAGCTCGAGCTGCTATGAAGTGTTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010257.2-142s1c1
Sequence:CCGGCTACAGGATGCATCATCTGGACTCGAGTCCAGATGATGCATCCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010257.2-261s1c1
Sequence:CCGGCATAGCAGACCTGTCCAAGAACTCGAGTTCTTGGACAGGTCTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-149s21c1
Sequence:CCGGTCATCTGGACCAGGGACCAATCTCGAGATTGGTCCCTGGTCCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-177s21c1
Sequence:CCGGTGGAACAGCGCCAGTTCAACACTCGAGTGTTGAACTGGCGCTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-104s21c1
Sequence:CCGGTTCTCGGAAGCTTCTTGGAAGCTCGAGCTTCCAAGAAGCTTCCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-240s21c1
Sequence:CCGGAGGGTCCTCAACACTTCATAGCTCGAGCTATGAAGTGTTGAGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-82s21c1
Sequence:CCGGCTTAGTGCTGGCTCTAGCTACCTCGAGGTAGCTAGAGCCAGCACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010257
GAST MISSION shRNA shRNA Plasmid DNA
gastrin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010257.2-248s1c1
Sequence:CCGGGTCCTCAACACTTCATAGCAGCTCGAGCTGCTATGAAGTGTTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010257.2-142s1c1
Sequence:CCGGCTACAGGATGCATCATCTGGACTCGAGTCCAGATGATGCATCCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010257.2-261s1c1
Sequence:CCGGCATAGCAGACCTGTCCAAGAACTCGAGTTCTTGGACAGGTCTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-149s21c1
Sequence:CCGGTCATCTGGACCAGGGACCAATCTCGAGATTGGTCCCTGGTCCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-177s21c1
Sequence:CCGGTGGAACAGCGCCAGTTCAACACTCGAGTGTTGAACTGGCGCTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-104s21c1
Sequence:CCGGTTCTCGGAAGCTTCTTGGAAGCTCGAGCTTCCAAGAAGCTTCCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-240s21c1
Sequence:CCGGAGGGTCCTCAACACTTCATAGCTCGAGCTATGAAGTGTTGAGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-82s21c1
Sequence:CCGGCTTAGTGCTGGCTCTAGCTACCTCGAGGTAGCTAGAGCCAGCACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010257
GAST MISSION shRNA Lentiviral Transduction Particles
gastrin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010257.2-248s1c1
Sequence:CCGGGTCCTCAACACTTCATAGCAGCTCGAGCTGCTATGAAGTGTTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010257.2-142s1c1
Sequence:CCGGCTACAGGATGCATCATCTGGACTCGAGTCCAGATGATGCATCCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010257.2-261s1c1
Sequence:CCGGCATAGCAGACCTGTCCAAGAACTCGAGTTCTTGGACAGGTCTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-149s21c1
Sequence:CCGGTCATCTGGACCAGGGACCAATCTCGAGATTGGTCCCTGGTCCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-177s21c1
Sequence:CCGGTGGAACAGCGCCAGTTCAACACTCGAGTGTTGAACTGGCGCTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-104s21c1
Sequence:CCGGTTCTCGGAAGCTTCTTGGAAGCTCGAGCTTCCAAGAAGCTTCCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-240s21c1
Sequence:CCGGAGGGTCCTCAACACTTCATAGCTCGAGCTATGAAGTGTTGAGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010257.3-82s21c1
Sequence:CCGGCTTAGTGCTGGCTCTAGCTACCTCGAGGTAGCTAGAGCCAGCACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000805
GAST MISSION shRNA Bacterial Glycerol Stock
gastrin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-120s21c1
Sequence:CCGGCCAGATGCACCCTTAGGTACACTCGAGTGTACCTAAGGGTGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-58s21c1
Sequence:CCGGTGATCTTTGCACTGGCTCTGGCTCGAGCCAGAGCCAGTGCAAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-79s21c1
Sequence:CCGGCCGCCTTCTCTGAAGCTTCTTCTCGAGAAGAAGCTTCAGAGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-191s21c1
Sequence:CCGGCTCTCATCATCGAAGGCAGCTCTCGAGAGCTGCCTTCGATGATGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-248s21c1
Sequence:CCGGGTCCAAGAAGCAGGGACCATGCTCGAGCATGGTCCCTGCTTCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000805
GAST MISSION shRNA shRNA Plasmid DNA
gastrin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-120s21c1
Sequence:CCGGCCAGATGCACCCTTAGGTACACTCGAGTGTACCTAAGGGTGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-58s21c1
Sequence:CCGGTGATCTTTGCACTGGCTCTGGCTCGAGCCAGAGCCAGTGCAAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-79s21c1
Sequence:CCGGCCGCCTTCTCTGAAGCTTCTTCTCGAGAAGAAGCTTCAGAGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-191s21c1
Sequence:CCGGCTCTCATCATCGAAGGCAGCTCTCGAGAGCTGCCTTCGATGATGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-248s21c1
Sequence:CCGGGTCCAAGAAGCAGGGACCATGCTCGAGCATGGTCCCTGCTTCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000805
GAST MISSION shRNA Lentiviral Transduction Particles
gastrin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-120s21c1
Sequence:CCGGCCAGATGCACCCTTAGGTACACTCGAGTGTACCTAAGGGTGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-58s21c1
Sequence:CCGGTGATCTTTGCACTGGCTCTGGCTCGAGCCAGAGCCAGTGCAAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-79s21c1
Sequence:CCGGCCGCCTTCTCTGAAGCTTCTTCTCGAGAAGAAGCTTCAGAGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-191s21c1
Sequence:CCGGCTCTCATCATCGAAGGCAGCTCTCGAGAGCTGCCTTCGATGATGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000805.3-248s21c1
Sequence:CCGGGTCCAAGAAGCAGGGACCATGCTCGAGCATGGTCCCTGCTTCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks