EMAIL THIS PAGE TO A FRIEND

GATA1

GATA binding protein 1 (globin transcription factor 1)

70 Gene Product Result for
Synonyms: ERYF1 GATA-1 GF-1 GF1 NF-E1 NFE1 XLANP XLTDA XLTT
UniProtKB ID: P15976, Q96GB8
Gene ID:
Human(2623) Summary: This gene encodes a protein which belongs to the GATA family of transcription factors. The protein plays an important role in erythroid development by regulating the switch of fetal hemoglobin to adult hemoglobin. Mutations in this gene have been associated with X-linked dyserythropoietic anemia and thrombocytopenia. [provided by RefSeq, Jul 2008]
Mouse(14460) GATA binding protein 1
Rat(25172) GATA binding protein 1
domestic guinea pig(100717706) GATA binding protein 1 (globin transcription factor 1)
naked mole-rat(101708095) GATA binding protein 1 (globin transcription factor 1)
sheep(100820747) GATA binding protein 1 (globin transcription factor 1)
Thale Cress(821990) GATA transcription factor 1
cow(516066) GATA binding protein 1 (globin transcription factor 1)
domestic cat(101096209) GATA binding protein 1 (globin transcription factor 1)
dog(480906) GATA binding protein 1 (globin transcription factor 1)
chicken(396450) GATA binding protein 1 (globin transcription factor 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300324 Anti-GATA1 (Ab-142) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300325 Anti-GATA1 (Ab-310) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB2500452 Anti-GATA1 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, mouse, rat, human
ELISA, western blot pricing
HPA000232 Anti-GATA1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2100897 Anti-GATA1 antibody produced in rabbit affinity isolated antibody canine, rat, rabbit, guinea pig, human, mouse, sheep, bovine
western blot pricing
G0290 Anti-GATA1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
microarray, western blot pricing
HPA000233 Anti-GATA1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
G4671 Anti-GATA1 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunohistochemistry, western blot pricing
SAB4501122 Anti-GATA1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501123 Anti-GATA1, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4300030 Anti-phospho-GATA1 (pSer142) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504414 Anti-phospho-GATA1 (pSer142) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300031 Anti-phospho-GATA1 (pSer310) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, western blot pricing
SAB4504415 Anti-phospho-GATA1 (pSer310) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB5300291 Monoclonal Anti-GATA1 antibody produced in mouse clone 4G1, ascites fluid human
ELISA, western blot pricing
SAB5300292 Monoclonal Anti-GATA1 antibody produced in mouse clone 4F5, ascites fluid human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1402205 Monoclonal Anti-GATA1 antibody produced in mouse clone 3G6, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008089 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008089 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008089 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002049 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024041 MISSION® esiRNA esiRNA human GATA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002049 Rosetta Predictions human pricing
NM_012764 Rosetta Predictions rat pricing
NM_008089 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333089 predicted 396
2 SASI_Hs01_00092057 predicted 446
3 SASI_Hs01_00092058 predicted 845
4 SASI_Hs02_00333090 predicted 888
5 SASI_Hs01_00092059 predicted 816
6 SASI_Hs01_00092060 predicted 985
7 SASI_Hs01_00092062 predicted 737
8 SASI_Hs01_00092064 predicted 965
9 SASI_Hs01_00092066 predicted 993
10 SASI_Hs02_00333091 predicted 848
11 SASI_Hs01_00092061 predicted 660
12 SASI_Hs01_00092063 predicted 905
13 SASI_Hs01_00092065 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058620 predicted 388
2 SASI_Rn01_00058621 predicted 792
3 SASI_Rn01_00058622 predicted 364
4 SASI_Rn01_00058623 predicted 689
5 SASI_Rn01_00058625 predicted 239
6 SASI_Rn01_00058626 predicted 876
7 SASI_Rn02_00260136 predicted 990
8 SASI_Rn02_00260137 predicted 1182
9 SASI_Rn01_00058628 predicted 1305
10 SASI_Rn02_00260138 predicted 677
11 SASI_Rn01_00058624 predicted 401
12 SASI_Rn01_00058627 predicted 488
13 SASI_Rn01_00058629 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023600 predicted 873
2 SASI_Mm01_00023601 predicted 449
3 SASI_Mm01_00023602 predicted 829
4 SASI_Mm01_00023603 predicted 825
5 SASI_Mm01_00023604 predicted 441
6 SASI_Mm01_00023605 predicted 796
7 SASI_Mm01_00023606 predicted 340
8 SASI_Mm01_00023607 predicted 230
9 SASI_Mm02_00313106 predicted 455
10 SASI_Mm01_00023608 predicted 814
11 SASI_Mm01_00023599 predicted 669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008089
GATA1 MISSION shRNA Bacterial Glycerol Stock
GATA binding protein 1 (globin transcription factor 1)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008089.1-1454s21c1
Sequence:CCGGACTGAGATTCAGGCATGTATTCTCGAGAATACATGCCTGAATCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-308s1c1
Sequence:CCGGGCTCAACAGTATGGAGGGAATCTCGAGATTCCCTCCATACTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-917s1c1
Sequence:CCGGCCTCTATTTCAAGCTCCATCACTCGAGTGATGGAGCTTGAAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-458s1c1
Sequence:CCGGCACGTTCTTGGACACCTTGAACTCGAGTTCAAGGTGTCCAAGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-187s1c1
Sequence:CCGGGTTTGGATGCAGCATCTTCTTCTCGAGAAGAAGATGCTGCATCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-948s1c1
Sequence:CCGGCCACTGACCATGAGGAAAGATCTCGAGATCTTTCCTCATGGTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008089
GATA1 MISSION shRNA shRNA Plasmid DNA
GATA binding protein 1 (globin transcription factor 1)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008089.1-1454s21c1
Sequence:CCGGACTGAGATTCAGGCATGTATTCTCGAGAATACATGCCTGAATCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-308s1c1
Sequence:CCGGGCTCAACAGTATGGAGGGAATCTCGAGATTCCCTCCATACTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-917s1c1
Sequence:CCGGCCTCTATTTCAAGCTCCATCACTCGAGTGATGGAGCTTGAAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-458s1c1
Sequence:CCGGCACGTTCTTGGACACCTTGAACTCGAGTTCAAGGTGTCCAAGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-187s1c1
Sequence:CCGGGTTTGGATGCAGCATCTTCTTCTCGAGAAGAAGATGCTGCATCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-948s1c1
Sequence:CCGGCCACTGACCATGAGGAAAGATCTCGAGATCTTTCCTCATGGTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008089
GATA1 MISSION shRNA Lentiviral Transduction Particles
GATA binding protein 1 (globin transcription factor 1)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008089.1-1454s21c1
Sequence:CCGGACTGAGATTCAGGCATGTATTCTCGAGAATACATGCCTGAATCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-308s1c1
Sequence:CCGGGCTCAACAGTATGGAGGGAATCTCGAGATTCCCTCCATACTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-917s1c1
Sequence:CCGGCCTCTATTTCAAGCTCCATCACTCGAGTGATGGAGCTTGAAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-458s1c1
Sequence:CCGGCACGTTCTTGGACACCTTGAACTCGAGTTCAAGGTGTCCAAGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-187s1c1
Sequence:CCGGGTTTGGATGCAGCATCTTCTTCTCGAGAAGAAGATGCTGCATCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008089.1-948s1c1
Sequence:CCGGCCACTGACCATGAGGAAAGATCTCGAGATCTTTCCTCATGGTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002049
GATA1 MISSION shRNA Bacterial Glycerol Stock
GATA binding protein 1 (globin transcription factor 1)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002049.3-628s21c1
Sequence:CCGGCCTCAATTCAGCAGCCTATTCCTCGAGGAATAGGCTGCTGAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002049.3-479s21c1
Sequence:CCGGACCAGCTTCCTGGAGACTTTGCTCGAGCAAAGTCTCCAGGAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002049.3-978s21c1
Sequence:CCGGCCATGCGGAAGGATGGTATTCCTCGAGGAATACCATCCTTCCGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002049.3-828s21c1
Sequence:CCGGAGCGCCTGATTGTCAGTAAACCTCGAGGTTTACTGACAATCAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002049.2-1357s1c1
Sequence:CCGGGCACAGAGCATGGCCTCCAGACTCGAGTCTGGAGGCCATGCTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002049.2-839s1c1
Sequence:CCGGCGGCCCAAGAAGCGCCTGATTCTCGAGAATCAGGCGCTTCTTGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002049.2-342s1c1
Sequence:CCGGTGTACCCATTGCTCAACTGTACTCGAGTACAGTTGAGCAATGGGTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002049.2-648s1c1
Sequence:CCGGCCCTCAATTCAGCAGCCTATTCTCGAGAATAGGCTGCTGAATTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002049.2-998s1c1
Sequence:CCGGACCATGCGGAAGGATGGTATTCTCGAGAATACCATCCTTCCGCATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002049
GATA1 MISSION shRNA shRNA Plasmid DNA
GATA binding protein 1 (globin transcription factor 1)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002049.3-628s21c1
Sequence:CCGGCCTCAATTCAGCAGCCTATTCCTCGAGGAATAGGCTGCTGAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002049.3-479s21c1
Sequence:CCGGACCAGCTTCCTGGAGACTTTGCTCGAGCAAAGTCTCCAGGAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002049.3-978s21c1
Sequence:CCGGCCATGCGGAAGGATGGTATTCCTCGAGGAATACCATCCTTCCGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002049.3-828s21c1
Sequence:CCGGAGCGCCTGATTGTCAGTAAACCTCGAGGTTTACTGACAATCAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002049.2-1357s1c1
Sequence:CCGGGCACAGAGCATGGCCTCCAGACTCGAGTCTGGAGGCCATGCTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002049.2-839s1c1
Sequence:CCGGCGGCCCAAGAAGCGCCTGATTCTCGAGAATCAGGCGCTTCTTGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002049.2-342s1c1
Sequence:CCGGTGTACCCATTGCTCAACTGTACTCGAGTACAGTTGAGCAATGGGTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002049.2-648s1c1
Sequence:CCGGCCCTCAATTCAGCAGCCTATTCTCGAGAATAGGCTGCTGAATTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002049.2-998s1c1
Sequence:CCGGACCATGCGGAAGGATGGTATTCTCGAGAATACCATCCTTCCGCATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002049
GATA1 MISSION shRNA Lentiviral Transduction Particles
GATA binding protein 1 (globin transcription factor 1)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002049.3-628s21c1
Sequence:CCGGCCTCAATTCAGCAGCCTATTCCTCGAGGAATAGGCTGCTGAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002049.3-479s21c1
Sequence:CCGGACCAGCTTCCTGGAGACTTTGCTCGAGCAAAGTCTCCAGGAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002049.3-978s21c1
Sequence:CCGGCCATGCGGAAGGATGGTATTCCTCGAGGAATACCATCCTTCCGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002049.3-828s21c1
Sequence:CCGGAGCGCCTGATTGTCAGTAAACCTCGAGGTTTACTGACAATCAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002049.2-1357s1c1
Sequence:CCGGGCACAGAGCATGGCCTCCAGACTCGAGTCTGGAGGCCATGCTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002049.2-839s1c1
Sequence:CCGGCGGCCCAAGAAGCGCCTGATTCTCGAGAATCAGGCGCTTCTTGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002049.2-342s1c1
Sequence:CCGGTGTACCCATTGCTCAACTGTACTCGAGTACAGTTGAGCAATGGGTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002049.2-648s1c1
Sequence:CCGGCCCTCAATTCAGCAGCCTATTCTCGAGAATAGGCTGCTGAATTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002049.2-998s1c1
Sequence:CCGGACCATGCGGAAGGATGGTATTCTCGAGAATACCATCCTTCCGCATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks