EMAIL THIS PAGE TO A FRIEND

GATA2

GATA binding protein 2

102 Gene Product Result for
Synonyms: DCML MONOMAC NFE1B
UniProtKB ID: P23769, D3DNB3, Q53YE0, Q96BH0, Q96BH8, Q9BUJ6
Gene ID:
Human(2624) Summary: This gene encodes a member of the GATA family of zinc-finger transcription factors that are named for the consensus nucleotide sequence they bind in the promoter regions of target genes. The encoded protein plays an essential role in regulating transcription of genes involved in the development and proliferation of hematopoietic and endocrine cell lineages. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
Mouse(14461) GATA binding protein 2
Rat(25159) GATA binding protein 2
Thale Cress(819112) GATA transcription factor 2
cow(506809) GATA binding protein 2
Horse(100049949) GATA binding protein 2
domestic cat(101088225) GATA binding protein 2
dog(484626) GATA binding protein 2
chicken(416018) GATA binding protein 2
sheep(100820748) GATA binding protein 2
naked mole-rat(101703409) GATA binding protein 2
domestic guinea pig(100723770) GATA binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA005633 Anti-GATA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV31855 Anti-GATA2 antibody produced in rabbit IgG fraction of antiserum canine, horse, bovine, human, mouse, guinea pig, rabbit, rat
immunohistochemistry, western blot pricing
SAB1410505 Anti-GATA2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB4504183 Anti-phospho-GATA2 (pSer401) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4301260 Anti-phospho-GATA2 (pSer401) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
WH0002624M1 Monoclonal Anti-GATA2 antibody produced in mouse clone 2D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409093 Monoclonal Anti-GATA2 antibody produced in mouse clone 1A5, ascites fluid, solution human
ELISA, western blot pricing
SAB1409094 Monoclonal Anti-GATA2 antibody produced in mouse clone 2F12, ascites fluid, solution human
ELISA, western blot pricing
SAB1403851 Monoclonal Anti-GATA2, (N-terminal) antibody produced in mouse clone 1G5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002050 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008090 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008090 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008090 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032638 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032638 Rosetta Predictions human pricing
NM_033442 Rosetta Predictions rat pricing
NM_008090 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106113 predicted 2057
2 SASI_Hs01_00106114 predicted 2051
3 SASI_Hs01_00106115 predicted 1515
4 SASI_Hs01_00106116 predicted 1564
5 SASI_Hs01_00106117 predicted 1561
6 SASI_Hs01_00106118 predicted 2130
7 SASI_Hs01_00106119 predicted 1947
8 SASI_Hs01_00106121 predicted 973
9 SASI_Hs02_00360191 predicted 2146
10 SASI_Hs02_00360192 predicted 1556
11 SASI_Hs01_00106112 predicted 2255
12 SASI_Hs01_00106120 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033442 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265552 predicted 1661
2 SASI_Rn02_00265553 predicted 1435
3 SASI_Rn02_00265554 predicted 1669
4 SASI_Rn01_00047668 predicted 1065
5 SASI_Rn01_00047669 predicted 1633
6 SASI_Rn02_00265555 predicted 1478
7 SASI_Rn01_00047672 predicted 1192
8 SASI_Rn01_00047673 predicted 1786
9 SASI_Rn01_00047674 predicted 1422
10 SASI_Rn02_00265556 predicted 1054
11 SASI_Rn01_00047670 predicted 1484
12 SASI_Rn01_00047671 predicted 1685
13 SASI_Rn01_00047675 predicted 940
14 SASI_Rn01_00047676 predicted 1564
15 SASI_Rn01_00047677 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313107 predicted 891
2 SASI_Mm01_00131759 predicted 1504
3 SASI_Mm01_00131760 predicted 1725
4 SASI_Mm01_00131761 predicted 1295
5 SASI_Mm01_00131763 predicted 878
6 SASI_Mm01_00131764 predicted 1766
7 SASI_Mm01_00131765 predicted 1376
8 SASI_Mm01_00131766 predicted 1234
9 SASI_Mm01_00131767 predicted 1175
10 SASI_Mm02_00313108 predicted 1043
11 SASI_Mm01_00131762 predicted 995
12 SASI_Mm01_00131768 predicted 1005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002050
GATA2 MISSION shRNA Bacterial Glycerol Stock
GATA binding protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-1326s1c1
Sequence:CCGGGTGCAAATTGTCAGACGACAACTCGAGTTGTCGTCTGACAATTTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-365s1c1
Sequence:CCGGCTGGCGCACAACTACATGGAACTCGAGTTCCATGTAGTTGTGCGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-1267s1c1
Sequence:CCGGCCGACCACTCATCAAGCCCAACTCGAGTTGGGCTTGATGAGTGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-1054s1c1
Sequence:CCGGCGACTACAGCAGCGGACTCTTCTCGAGAAGAGTCCGCTGCTGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-1468s1c1
Sequence:CCGGGAACCGGAAGATGTCCAACAACTCGAGTTGTTGGACATCTTCCGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002050
GATA2 MISSION shRNA shRNA Plasmid DNA
GATA binding protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-1326s1c1
Sequence:CCGGGTGCAAATTGTCAGACGACAACTCGAGTTGTCGTCTGACAATTTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-365s1c1
Sequence:CCGGCTGGCGCACAACTACATGGAACTCGAGTTCCATGTAGTTGTGCGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-1267s1c1
Sequence:CCGGCCGACCACTCATCAAGCCCAACTCGAGTTGGGCTTGATGAGTGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-1054s1c1
Sequence:CCGGCGACTACAGCAGCGGACTCTTCTCGAGAAGAGTCCGCTGCTGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-1468s1c1
Sequence:CCGGGAACCGGAAGATGTCCAACAACTCGAGTTGTTGGACATCTTCCGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002050
GATA2 MISSION shRNA Lentiviral Transduction Particles
GATA binding protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-1326s1c1
Sequence:CCGGGTGCAAATTGTCAGACGACAACTCGAGTTGTCGTCTGACAATTTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-365s1c1
Sequence:CCGGCTGGCGCACAACTACATGGAACTCGAGTTCCATGTAGTTGTGCGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-1267s1c1
Sequence:CCGGCCGACCACTCATCAAGCCCAACTCGAGTTGGGCTTGATGAGTGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-1054s1c1
Sequence:CCGGCGACTACAGCAGCGGACTCTTCTCGAGAAGAGTCCGCTGCTGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002050.2-1468s1c1
Sequence:CCGGGAACCGGAAGATGTCCAACAACTCGAGTTGTTGGACATCTTCCGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008090
VALIDATED
GATA2 MISSION shRNA Bacterial Glycerol Stock
GATA binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008090.3-2490s1c1
Sequence:CCGGCCCTGTAAATACAACCTTCTTCTCGAGAAGAAGGTTGTATTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008090.3-301s1c1
Sequence:CCGGCGCCGTATTGAATGCGCAGTACTCGAGTACTGCGCATTCAATACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008090.3-977s1c1
Sequence:CCGGCCTGCAACACACCACCCGATACTCGAGTATCGGGTGGTGTGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008090.3-1447s1c1
Sequence:CCGGGAATCGGAAGATGTCCAGCAACTCGAGTTGCTGGACATCTTCCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008090.3-1382s1c1
Sequence:CCGGCTCTACTACAAGCTGCACAATCTCGAGATTGTGCAGCTTGTAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008090.5-1221s21c1
Sequence:CCGGGGCTCTACCACAAGATGAATGCTCGAGCATTCATCTTGTGGTAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008090.5-1321s21c1
Sequence:CCGGGACGACAACCACCACCTTATGCTCGAGCATAAGGTGGTGGTTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008090.5-1888s21c1
Sequence:CCGGCCGCCATTACTGTGAATATTTCTCGAGAAATATTCACAGTAATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008090.5-1390s21c1
Sequence:CCGGCTACAAGCTGCACAATGTTAACTCGAGTTAACATTGTGCAGCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008090.5-1297s21c1
Sequence:CCGGGGGCACCTGTTGTGCAAATTGCTCGAGCAATTTGCACAACAGGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008090
VALIDATED
GATA2 MISSION shRNA shRNA Plasmid DNA
GATA binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008090.3-2490s1c1
Sequence:CCGGCCCTGTAAATACAACCTTCTTCTCGAGAAGAAGGTTGTATTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008090.3-301s1c1
Sequence:CCGGCGCCGTATTGAATGCGCAGTACTCGAGTACTGCGCATTCAATACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008090.3-977s1c1
Sequence:CCGGCCTGCAACACACCACCCGATACTCGAGTATCGGGTGGTGTGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008090.3-1447s1c1
Sequence:CCGGGAATCGGAAGATGTCCAGCAACTCGAGTTGCTGGACATCTTCCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008090.3-1382s1c1
Sequence:CCGGCTCTACTACAAGCTGCACAATCTCGAGATTGTGCAGCTTGTAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008090.5-1221s21c1
Sequence:CCGGGGCTCTACCACAAGATGAATGCTCGAGCATTCATCTTGTGGTAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008090.5-1321s21c1
Sequence:CCGGGACGACAACCACCACCTTATGCTCGAGCATAAGGTGGTGGTTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008090.5-1888s21c1
Sequence:CCGGCCGCCATTACTGTGAATATTTCTCGAGAAATATTCACAGTAATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008090.5-1390s21c1
Sequence:CCGGCTACAAGCTGCACAATGTTAACTCGAGTTAACATTGTGCAGCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008090.5-1297s21c1
Sequence:CCGGGGGCACCTGTTGTGCAAATTGCTCGAGCAATTTGCACAACAGGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008090
VALIDATED
GATA2 MISSION shRNA Lentiviral Transduction Particles
GATA binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008090.3-2490s1c1
Sequence:CCGGCCCTGTAAATACAACCTTCTTCTCGAGAAGAAGGTTGTATTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008090.3-301s1c1
Sequence:CCGGCGCCGTATTGAATGCGCAGTACTCGAGTACTGCGCATTCAATACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008090.3-977s1c1
Sequence:CCGGCCTGCAACACACCACCCGATACTCGAGTATCGGGTGGTGTGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008090.3-1447s1c1
Sequence:CCGGGAATCGGAAGATGTCCAGCAACTCGAGTTGCTGGACATCTTCCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008090.3-1382s1c1
Sequence:CCGGCTCTACTACAAGCTGCACAATCTCGAGATTGTGCAGCTTGTAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008090.5-1221s21c1
Sequence:CCGGGGCTCTACCACAAGATGAATGCTCGAGCATTCATCTTGTGGTAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008090.5-1321s21c1
Sequence:CCGGGACGACAACCACCACCTTATGCTCGAGCATAAGGTGGTGGTTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008090.5-1888s21c1
Sequence:CCGGCCGCCATTACTGTGAATATTTCTCGAGAAATATTCACAGTAATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008090.5-1390s21c1
Sequence:CCGGCTACAAGCTGCACAATGTTAACTCGAGTTAACATTGTGCAGCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008090.5-1297s21c1
Sequence:CCGGGGGCACCTGTTGTGCAAATTGCTCGAGCAATTTGCACAACAGGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032638
GATA2 MISSION shRNA Bacterial Glycerol Stock
GATA binding protein 2
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000355783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032638.4-1393s21c1
Sequence:CCGGGACGACAACCACCACCTTATGCTCGAGCATAAGGTGGTGGTTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032638.4-1368s21c1
Sequence:CCGGCCGGCACCTGTTGTGCAAATTCTCGAGAATTTGCACAACAGGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032638.4-1827s21c1
Sequence:CCGGACCCTTAGCAGCCCAGCATTTCTCGAGAAATGCTGGGCTGCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032638
GATA2 MISSION shRNA shRNA Plasmid DNA
GATA binding protein 2
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000355783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032638.4-1393s21c1
Sequence:CCGGGACGACAACCACCACCTTATGCTCGAGCATAAGGTGGTGGTTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032638.4-1368s21c1
Sequence:CCGGCCGGCACCTGTTGTGCAAATTCTCGAGAATTTGCACAACAGGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032638.4-1827s21c1
Sequence:CCGGACCCTTAGCAGCCCAGCATTTCTCGAGAAATGCTGGGCTGCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032638
GATA2 MISSION shRNA Lentiviral Transduction Particles
GATA binding protein 2
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000355783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032638.4-1393s21c1
Sequence:CCGGGACGACAACCACCACCTTATGCTCGAGCATAAGGTGGTGGTTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032638.4-1368s21c1
Sequence:CCGGCCGGCACCTGTTGTGCAAATTCTCGAGAATTTGCACAACAGGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032638.4-1827s21c1
Sequence:CCGGACCCTTAGCAGCCCAGCATTTCTCGAGAAATGCTGGGCTGCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks