EMAIL THIS PAGE TO A FRIEND

GATA3

GATA binding protein 3

150 Gene Product Result for
Synonyms: HDR HDRS
UniProtKB ID: P23771, Q5VWG7, Q5VWG8, Q96J16
Gene ID:
Human(2625) Summary: This gene encodes a protein which belongs to the GATA family of transcription factors. The protein contains two GATA-type zinc fingers and is an important regulator of T-cell development and plays an important role in endothelial cell biology. Defects in this gene are the cause of hypoparathyroidism with sensorineural deafness and renal dysplasia. [provided by RefSeq, Nov 2009]
Mouse(14462) GATA binding protein 3
Rat(85471) GATA binding protein 3
Zebrafish(30458) GATA-binding protein 3
cow(505169) GATA binding protein 3
domestic cat(101083271) GATA binding protein 3
dog(487134) GATA binding protein 3
chicken(419106) GATA binding protein 3
Thale Cress(829620) GATA transcription factor 3
domestic guinea pig(100725221) GATA binding protein 3
naked mole-rat(101698767) GATA binding protein 3
sheep(101115981) GATA binding protein 3
sheep(780483) GATA binding protein 3
Domestic Rabbit(100347169) GATA binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501136 Anti-GATA3 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
SAB1405853 Anti-GATA3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV32548 Anti-GATA3 antibody produced in rabbit affinity isolated antibody bovine, canine, pig, human, rabbit, sheep, guinea pig, rat, mouse, horse
immunohistochemistry, western blot pricing
SAB2100898 Anti-GATA3 antibody produced in rabbit affinity isolated antibody guinea pig, zebrafish, pig, canine, bovine, rat, horse, rabbit, sheep, human, mouse
western blot pricing
SAB3500250 Anti-GATA3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA029731 Anti-GATA3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501126 Anti-GATA3 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4504184 Anti-phospho-GATA3 (pSer308) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence pricing
SAB4301577 Anti-phospho-GATA3 (pSer308) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
WH0002625M1 Monoclonal Anti-GATA3 antibody produced in mouse clone 1C1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403852 Monoclonal Anti-GATA3 antibody produced in mouse clone 2H5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300457 Monoclonal Anti-GATA3 antibody produced in mouse clone 1A10D1, ascites fluid human
ELISA, western blot pricing
SAB5300458 Monoclonal Anti-GATA3 antibody produced in mouse clone 7B5, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008091 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008091 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008091 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002051 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002295 Rosetta Predictions human pricing
NM_002051 Rosetta Predictions human pricing
NM_133293 Rosetta Predictions rat pricing
NM_008091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153931 predicted 1529
2 SASI_Hs01_00153932 predicted 1880
3 SASI_Hs01_00153933 predicted 1582
4 SASI_Hs01_00153934 predicted 665
5 SASI_Hs01_00153935 predicted 718
6 SASI_Hs01_00153936 predicted 1575
7 SASI_Hs01_00153937 predicted 1915
8 SASI_Hs01_00153939 predicted 2264
9 SASI_Hs01_00153940 predicted 2195
10 SASI_Hs02_00304187 predicted 2237
11 SASI_Hs01_00153938 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121156 predicted 1535
2 SASI_Hs01_00121157 predicted 1881
3 SASI_Hs01_00121158 predicted 1580
4 SASI_Hs01_00121159 predicted 665
5 SASI_Hs01_00121160 predicted 724
6 SASI_Hs01_00121161 predicted 1572
7 SASI_Hs01_00121162 predicted 1920
8 SASI_Hs01_00121164 predicted 1932
9 SASI_Hs01_00121165 predicted 2236
10 SASI_Hs02_00333092 predicted 2196
11 SASI_Hs01_00121163 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091131 predicted 896
2 SASI_Rn01_00091132 predicted 974
3 SASI_Rn01_00091133 predicted 666
4 SASI_Rn01_00091134 predicted 533
5 SASI_Rn01_00091135 predicted 1097
6 SASI_Rn01_00091136 predicted 1025
7 SASI_Rn01_00091137 predicted 1031
8 SASI_Rn01_00091138 predicted 673
9 SASI_Rn01_00091140 predicted 239
10 SASI_Rn02_00267576 predicted 386
11 SASI_Rn01_00091139 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169412 predicted 1250
2 SASI_Mm01_00169413 predicted 1524
3 SASI_Mm01_00169414 predicted 1618
4 SASI_Mm01_00169415 predicted 1480
5 SASI_Mm02_00313109 predicted 1614
6 SASI_Mm01_00169416 predicted 1122
7 SASI_Mm01_00169417 predicted 713
8 SASI_Mm01_00169418 predicted 1260
9 SASI_Mm01_00169419 predicted 1683
10 SASI_Mm01_00169420 predicted 2019
11 SASI_Mm01_00169421 predicted 1766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008091
GATA3 MISSION shRNA Bacterial Glycerol Stock
GATA binding protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008091.3-2402s21c1
Sequence:CCGGCAGTTGTTTGATGCATTTAAACTCGAGTTTAAATGCATCAAACAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008091.3-767s21c1
Sequence:CCGGTCCCGTCCTACTACGGAAACTCTCGAGAGTTTCCGTAGTAGGACGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008091.3-2202s21c1
Sequence:CCGGATTGCTGAACATTGCATATAACTCGAGTTATATGCAATGTTCAGCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008091.2-2265s1c1
Sequence:CCGGCCCTGTAATTGTTGTTTGTATCTCGAGATACAAACAACAATTACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008091.2-1043s1c1
Sequence:CCGGGCCTGCGGACTCTACCATAAACTCGAGTTTATGGTAGAGTCCGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008091.2-299s1c1
Sequence:CCGGGCTCAGTATCCGCTGACGGAACTCGAGTTCCGTCAGCGGATACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008091.2-925s1c1
Sequence:CCGGCGGATGTAAGTCGAGGCCCAACTCGAGTTGGGCCTCGACTTACATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008091.2-1213s1c1
Sequence:CCGGGCTGTACTACAAGCTTCATAACTCGAGTTATGAAGCTTGTAGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008091
GATA3 MISSION shRNA shRNA Plasmid DNA
GATA binding protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008091.3-2402s21c1
Sequence:CCGGCAGTTGTTTGATGCATTTAAACTCGAGTTTAAATGCATCAAACAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008091.3-767s21c1
Sequence:CCGGTCCCGTCCTACTACGGAAACTCTCGAGAGTTTCCGTAGTAGGACGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008091.3-2202s21c1
Sequence:CCGGATTGCTGAACATTGCATATAACTCGAGTTATATGCAATGTTCAGCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008091.2-2265s1c1
Sequence:CCGGCCCTGTAATTGTTGTTTGTATCTCGAGATACAAACAACAATTACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008091.2-1043s1c1
Sequence:CCGGGCCTGCGGACTCTACCATAAACTCGAGTTTATGGTAGAGTCCGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008091.2-299s1c1
Sequence:CCGGGCTCAGTATCCGCTGACGGAACTCGAGTTCCGTCAGCGGATACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008091.2-925s1c1
Sequence:CCGGCGGATGTAAGTCGAGGCCCAACTCGAGTTGGGCCTCGACTTACATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008091.2-1213s1c1
Sequence:CCGGGCTGTACTACAAGCTTCATAACTCGAGTTATGAAGCTTGTAGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008091
GATA3 MISSION shRNA Lentiviral Transduction Particles
GATA binding protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008091.3-2402s21c1
Sequence:CCGGCAGTTGTTTGATGCATTTAAACTCGAGTTTAAATGCATCAAACAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008091.3-767s21c1
Sequence:CCGGTCCCGTCCTACTACGGAAACTCTCGAGAGTTTCCGTAGTAGGACGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008091.3-2202s21c1
Sequence:CCGGATTGCTGAACATTGCATATAACTCGAGTTATATGCAATGTTCAGCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008091.2-2265s1c1
Sequence:CCGGCCCTGTAATTGTTGTTTGTATCTCGAGATACAAACAACAATTACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008091.2-1043s1c1
Sequence:CCGGGCCTGCGGACTCTACCATAAACTCGAGTTTATGGTAGAGTCCGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008091.2-299s1c1
Sequence:CCGGGCTCAGTATCCGCTGACGGAACTCGAGTTCCGTCAGCGGATACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008091.2-925s1c1
Sequence:CCGGCGGATGTAAGTCGAGGCCCAACTCGAGTTGGGCCTCGACTTACATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008091.2-1213s1c1
Sequence:CCGGGCTGTACTACAAGCTTCATAACTCGAGTTATGAAGCTTGTAGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002051
VALIDATED
GATA3 MISSION shRNA Bacterial Glycerol Stock
GATA binding protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002051.2-1637s21c1
Sequence:CCGGCATCCAGACCAGAAACCGAAACTCGAGTTTCGGTTTCTGGTCTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002051.2-1713s21c1
Sequence:CCGGCCCAAGAACAGCTCGTTTAACCTCGAGGTTAAACGAGCTGTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002051.2-1974s21c1
Sequence:CCGGAGCCTAAACGCGATGGATATACTCGAGTATATCCATCGCGTTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002051.2-1537s21c1
Sequence:CCGGTCTGGAGGAGGAATGCCAATGCTCGAGCATTGGCATTCCTCCTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002051.2-1579s21c1
Sequence:CCGGGTGGGCTCTACTACAAGCTTCCTCGAGGAAGCTTGTAGTAGAGCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002051.1-1835s1c1
Sequence:CCGGGCCAAGAAGTTTAAGGAATATCTCGAGATATTCCTTAAACTTCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002051.1-688s1c1
Sequence:CCGGCGAGAAAGAGTGCCTCAAGTACTCGAGTACTTGAGGCACTCTTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002051.1-892s1c1
Sequence:CCGGCGGATGCAAGTCCAGGCCCAACTCGAGTTGGGCCTGGACTTGCATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002051.1-413s1c1
Sequence:CCGGCCTCTGCTTCATGGATCCCTACTCGAGTAGGGATCCATGAAGCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002051
VALIDATED
GATA3 MISSION shRNA shRNA Plasmid DNA
GATA binding protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002051.2-1637s21c1
Sequence:CCGGCATCCAGACCAGAAACCGAAACTCGAGTTTCGGTTTCTGGTCTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002051.2-1713s21c1
Sequence:CCGGCCCAAGAACAGCTCGTTTAACCTCGAGGTTAAACGAGCTGTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002051.2-1974s21c1
Sequence:CCGGAGCCTAAACGCGATGGATATACTCGAGTATATCCATCGCGTTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002051.2-1537s21c1
Sequence:CCGGTCTGGAGGAGGAATGCCAATGCTCGAGCATTGGCATTCCTCCTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002051.2-1579s21c1
Sequence:CCGGGTGGGCTCTACTACAAGCTTCCTCGAGGAAGCTTGTAGTAGAGCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002051.1-1835s1c1
Sequence:CCGGGCCAAGAAGTTTAAGGAATATCTCGAGATATTCCTTAAACTTCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002051.1-688s1c1
Sequence:CCGGCGAGAAAGAGTGCCTCAAGTACTCGAGTACTTGAGGCACTCTTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002051.1-892s1c1
Sequence:CCGGCGGATGCAAGTCCAGGCCCAACTCGAGTTGGGCCTGGACTTGCATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002051.1-413s1c1
Sequence:CCGGCCTCTGCTTCATGGATCCCTACTCGAGTAGGGATCCATGAAGCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002051
VALIDATED
GATA3 MISSION shRNA Lentiviral Transduction Particles
GATA binding protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002051.2-1637s21c1
Sequence:CCGGCATCCAGACCAGAAACCGAAACTCGAGTTTCGGTTTCTGGTCTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002051.2-1713s21c1
Sequence:CCGGCCCAAGAACAGCTCGTTTAACCTCGAGGTTAAACGAGCTGTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002051.2-1974s21c1
Sequence:CCGGAGCCTAAACGCGATGGATATACTCGAGTATATCCATCGCGTTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002051.2-1537s21c1
Sequence:CCGGTCTGGAGGAGGAATGCCAATGCTCGAGCATTGGCATTCCTCCTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002051.2-1579s21c1
Sequence:CCGGGTGGGCTCTACTACAAGCTTCCTCGAGGAAGCTTGTAGTAGAGCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002051.1-1835s1c1
Sequence:CCGGGCCAAGAAGTTTAAGGAATATCTCGAGATATTCCTTAAACTTCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002051.1-688s1c1
Sequence:CCGGCGAGAAAGAGTGCCTCAAGTACTCGAGTACTTGAGGCACTCTTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002051.1-892s1c1
Sequence:CCGGCGGATGCAAGTCCAGGCCCAACTCGAGTTGGGCCTGGACTTGCATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002051.1-413s1c1
Sequence:CCGGCCTCTGCTTCATGGATCCCTACTCGAGTAGGGATCCATGAAGCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)