EMAIL THIS PAGE TO A FRIEND

GATA4

GATA binding protein 4

76 Gene Product Result for
Synonyms: ASD2 VSD1
UniProtKB ID: P43694, B7ZKX0, Q3MJ45, Q5IFM8
Gene ID:
Human(2626) Summary: This gene encodes a member of the GATA family of zinc-finger transcription factors. Members of this family recognize the GATA motif which is present in the promoters of many genes. This protein is thought to regulate genes involved in embryogenesis and in myocardial differentiation and function. Mutations in this gene have been associated with cardiac septal defects. [provided by RefSeq, Jul 2008]
Mouse(14463) GATA binding protein 4
Rat(54254) GATA binding protein 4
Zebrafish(30483) GATA-binding protein 4
Thale Cress(825224) GATA transcription factor 4
chicken(396392) GATA binding protein 4
cow(327716) GATA binding protein 4
domestic cat(101086140) GATA binding protein 4
dog(486079) GATA binding protein 4
sheep(100820749) GATA binding protein 4
naked mole-rat(101707576) GATA binding protein 4
domestic guinea pig(100716226) GATA binding protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300646 Anti-GATA-4 antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
G8794 Anti-GATA4 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension mouse, rat, human
immunocytochemistry, western blot pricing
AV38100 Anti-GATA4 antibody produced in rabbit affinity isolated antibody rabbit, pig, human, rat, canine, mouse
western blot pricing
SAB4501128 Anti-GATA4 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB4501129 Anti-GATA4 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, western blot pricing
SAB4501130 Anti-GATA4 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
HPA073899 Anti-GATA4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
G8044 Anti-phospho-GATA4 (pSer105) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mammals, mouse
western blot pricing
SAB4504186 Anti-phospho-GATA4 (pSer105) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence pricing
SAB4301540 Anti-phospho-GATA4 (pSer105) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4504185 Anti-phospho-GATA4 (pSer262) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, western blot pricing
SAB4301539 Anti-phospho-GATA4 (pSer262) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB3300090 Monoclonal Anti-GATA4 antibody produced in mouse clone 9F9, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB5300290 Monoclonal Anti-GATA4 antibody produced in mouse clone 6H10, ascites fluid human, mouse
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1478 Human GATA4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002052 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008092 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008092 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008092 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002052 Rosetta Predictions human pricing
NM_144730 Rosetta Predictions rat pricing
NM_008092 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212511 predicted 1694
2 SASI_Hs01_00212512 predicted 2122
3 SASI_Hs01_00212513 predicted 2108
4 SASI_Hs01_00212514 predicted 1190
5 SASI_Hs01_00212515 predicted 1158
6 SASI_Hs01_00212516 predicted 2367
7 SASI_Hs01_00212517 predicted 2272
8 SASI_Hs01_00212519 predicted 2010
9 SASI_Hs01_00212520 predicted 1625
10 SASI_Hs02_00333093 predicted 1289
11 SASI_Hs01_00212518 predicted 1848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070083 predicted 1170
2 SASI_Rn01_00070084 predicted 2311
3 SASI_Rn01_00070085 predicted 1978
4 SASI_Rn01_00070086 predicted 2361
5 SASI_Rn01_00070087 predicted 2045
6 SASI_Rn01_00070088 predicted 700
7 SASI_Rn01_00070089 predicted 2004
8 SASI_Rn01_00070090 predicted 2032
9 SASI_Rn01_00070091 predicted 2021
10 SASI_Rn01_00070092 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025092 predicted 1826
2 SASI_Mm01_00025093 predicted 1214
3 SASI_Mm01_00025094 predicted 1443
4 SASI_Mm01_00025095 predicted 1908
5 SASI_Mm01_00025096 predicted 2267
6 SASI_Mm01_00025097 predicted 2359
7 SASI_Mm01_00025098 predicted 2054
8 SASI_Mm01_00025099 predicted 2060
9 SASI_Mm01_00025100 predicted 2364
10 SASI_Mm01_00025101 predicted 1750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002052
VALIDATED
GATA4 MISSION shRNA Bacterial Glycerol Stock
GATA binding protein 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002052.2-2922s1c1
Sequence:CCGGCCAGAGATTCTGCAACACGAACTCGAGTTCGTGTTGCAGAATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002052.2-1491s1c1
Sequence:CCGGCTGAATAAATCTAAGACACCACTCGAGTGGTGTCTTAGATTTATTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002052.2-1592s1c1
Sequence:CCGGCGAGGAGATGCGTCCCATCAACTCGAGTTGATGGGACGCATCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002052.2-1130s1c1
Sequence:CCGGTCTCGATATGTTTGACGACTTCTCGAGAAGTCGTCAAACATATCGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002052.3-1628s21c1
Sequence:CCGGCGAGGAGATGCGTCCCATCAACTCGAGTTGATGGGACGCATCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002052.3-2958s21c1
Sequence:CCGGCCAGAGATTCTGCAACACGAACTCGAGTTCGTGTTGCAGAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002052.3-1513s21c1
Sequence:CCGGGGAAGCCCAAGAACCTGAATACTCGAGTATTCAGGTTCTTGGGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002052.3-1865s21c1
Sequence:CCGGGGACATAATCACTGCGTAATCCTCGAGGATTACGCAGTGATTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002052
VALIDATED
GATA4 MISSION shRNA shRNA Plasmid DNA
GATA binding protein 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002052.2-2922s1c1
Sequence:CCGGCCAGAGATTCTGCAACACGAACTCGAGTTCGTGTTGCAGAATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002052.2-1491s1c1
Sequence:CCGGCTGAATAAATCTAAGACACCACTCGAGTGGTGTCTTAGATTTATTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002052.2-1592s1c1
Sequence:CCGGCGAGGAGATGCGTCCCATCAACTCGAGTTGATGGGACGCATCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002052.2-1130s1c1
Sequence:CCGGTCTCGATATGTTTGACGACTTCTCGAGAAGTCGTCAAACATATCGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002052.3-1628s21c1
Sequence:CCGGCGAGGAGATGCGTCCCATCAACTCGAGTTGATGGGACGCATCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002052.3-2958s21c1
Sequence:CCGGCCAGAGATTCTGCAACACGAACTCGAGTTCGTGTTGCAGAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002052.3-1513s21c1
Sequence:CCGGGGAAGCCCAAGAACCTGAATACTCGAGTATTCAGGTTCTTGGGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002052.3-1865s21c1
Sequence:CCGGGGACATAATCACTGCGTAATCCTCGAGGATTACGCAGTGATTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002052
VALIDATED
GATA4 MISSION shRNA Lentiviral Transduction Particles
GATA binding protein 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002052.2-2922s1c1
Sequence:CCGGCCAGAGATTCTGCAACACGAACTCGAGTTCGTGTTGCAGAATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002052.2-1491s1c1
Sequence:CCGGCTGAATAAATCTAAGACACCACTCGAGTGGTGTCTTAGATTTATTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002052.2-1592s1c1
Sequence:CCGGCGAGGAGATGCGTCCCATCAACTCGAGTTGATGGGACGCATCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002052.2-1130s1c1
Sequence:CCGGTCTCGATATGTTTGACGACTTCTCGAGAAGTCGTCAAACATATCGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002052.3-1628s21c1
Sequence:CCGGCGAGGAGATGCGTCCCATCAACTCGAGTTGATGGGACGCATCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002052.3-2958s21c1
Sequence:CCGGCCAGAGATTCTGCAACACGAACTCGAGTTCGTGTTGCAGAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002052.3-1513s21c1
Sequence:CCGGGGAAGCCCAAGAACCTGAATACTCGAGTATTCAGGTTCTTGGGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002052.3-1865s21c1
Sequence:CCGGGGACATAATCACTGCGTAATCCTCGAGGATTACGCAGTGATTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008092
GATA4 MISSION shRNA Bacterial Glycerol Stock
GATA binding protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008092.2-3234s1c1
Sequence:CCGGCGAACCAAGATTCTGTTGTAACTCGAGTTACAACAGAATCTTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008092.2-1566s1c1
Sequence:CCGGAGCCCAAGAACCTGAATAAATCTCGAGATTTATTCAGGTTCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008092.2-1836s1c1
Sequence:CCGGCATCTCCTGTCACTCAGACATCTCGAGATGTCTGAGTGACAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008092.2-1241s1c1
Sequence:CCGGGAAGGCAGAGAGTGTGTCAATCTCGAGATTGACACACTCTCTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008092.2-1211s1c1
Sequence:CCGGCCCAATCTCGATATGTTTGATCTCGAGATCAAACATATCGAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008092
GATA4 MISSION shRNA shRNA Plasmid DNA
GATA binding protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008092.2-3234s1c1
Sequence:CCGGCGAACCAAGATTCTGTTGTAACTCGAGTTACAACAGAATCTTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008092.2-1566s1c1
Sequence:CCGGAGCCCAAGAACCTGAATAAATCTCGAGATTTATTCAGGTTCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008092.2-1836s1c1
Sequence:CCGGCATCTCCTGTCACTCAGACATCTCGAGATGTCTGAGTGACAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008092.2-1241s1c1
Sequence:CCGGGAAGGCAGAGAGTGTGTCAATCTCGAGATTGACACACTCTCTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008092.2-1211s1c1
Sequence:CCGGCCCAATCTCGATATGTTTGATCTCGAGATCAAACATATCGAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008092
GATA4 MISSION shRNA Lentiviral Transduction Particles
GATA binding protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008092.2-3234s1c1
Sequence:CCGGCGAACCAAGATTCTGTTGTAACTCGAGTTACAACAGAATCTTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008092.2-1566s1c1
Sequence:CCGGAGCCCAAGAACCTGAATAAATCTCGAGATTTATTCAGGTTCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008092.2-1836s1c1
Sequence:CCGGCATCTCCTGTCACTCAGACATCTCGAGATGTCTGAGTGACAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008092.2-1241s1c1
Sequence:CCGGGAAGGCAGAGAGTGTGTCAATCTCGAGATTGACACACTCTCTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008092.2-1211s1c1
Sequence:CCGGCCCAATCTCGATATGTTTGATCTCGAGATCAAACATATCGAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks