EMAIL THIS PAGE TO A FRIEND

GATA5

GATA binding protein 5

Synonyms: GATAS bB379O24.1
UniProtKB ID: Q9BWX5, Q17RE2
Gene ID:
Human(140628) Summary: The protein encoded by this gene is a transcription factor that contains two GATA-type zinc fingers. The encoded protein is known to bind to hepatocyte nuclear factor-1alpha (HNF-1alpha), and this interaction is essential for cooperative activation of the intestinal lactase-phlorizin hydrolase promoter. In other organisms, similar proteins may be involved in the establishment of cardiac smooth muscle cell diversity. [provided by RefSeq, Jul 2008]
Mouse(14464) GATA binding protein 5
Rat(499951) GATA binding protein 5
domestic guinea pig(100719097) GATA binding protein 5
naked mole-rat(101704511) GATA binding protein 5
sheep(100820750) GATA binding protein 5
Zebrafish(30482) GATA-binding protein 5
Thale Cress(836764) GATA transcription factor 5
chicken(396391) GATA binding protein 5
dog(485961) GATA binding protein 5
cow(504784) GATA binding protein 5
domestic cat(101083161) GATA binding protein 5
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080473 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130831 MISSION® esiRNA esiRNA human GATA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080473 Rosetta Predictions human pricing
NM_001024316 Rosetta Predictions rat pricing
NM_008093 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215717 predicted 414
2 SASI_Hs01_00215718 predicted 925
3 SASI_Hs01_00215719 predicted 1562
4 SASI_Hs01_00215720 predicted 1146
5 SASI_Hs01_00215721 predicted 1577
6 SASI_Hs01_00215722 predicted 1127
7 SASI_Hs01_00215723 predicted 576
8 SASI_Hs01_00215724 predicted 1402
9 SASI_Hs01_00215725 predicted 1022
10 SASI_Hs01_00215726 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048768 predicted 1170
2 SASI_Rn01_00048769 predicted 719
3 SASI_Rn01_00048770 predicted 1501
4 SASI_Rn01_00048771 predicted 1008
5 SASI_Rn01_00048772 predicted 1737
6 SASI_Rn01_00048773 predicted 328
7 SASI_Rn02_00202528 predicted 1723
8 SASI_Rn01_00048774 predicted 488
9 SASI_Rn01_00048775 predicted 1255
10 SASI_Rn01_00048776 predicted 1752
11 SASI_Rn01_00048777 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154944 predicted 1855
2 SASI_Mm01_00154945 predicted 1598
3 SASI_Mm02_00313110 predicted 1731
4 SASI_Mm01_00154947 predicted 1744
5 SASI_Mm01_00154948 predicted 577
6 SASI_Mm02_00313111 predicted 1728
7 SASI_Mm02_00313112 predicted 1967
8 SASI_Mm01_00154950 predicted 1979
9 SASI_Mm01_00154951 predicted 1045
10 SASI_Mm01_00154953 predicted 1398
11 SASI_Mm01_00154946 predicted 1271
12 SASI_Mm01_00154949 predicted 1520
13 SASI_Mm01_00154952 predicted 1560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080473
GATA5 MISSION shRNA Bacterial Glycerol Stock
GATA binding protein 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080473.4-971s21c1
Sequence:CCGGCTCAGGATCCACAAGGAATGCCTCGAGGCATTCCTTGTGGATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080473.4-1560s21c1
Sequence:CCGGACCACCACCACCAACTTGAATCTCGAGATTCAAGTTGGTGGTGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080473.4-1752s21c1
Sequence:CCGGTCATTGCCCACATGGATAGACCTCGAGGTCTATCCATGTGGGCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080473.3-938s1c1
Sequence:CCGGGAAGCCAAAGACCATCGCCAACTCGAGTTGGCGATGGTCTTTGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080473.3-896s1c1
Sequence:CCGGGCCTCTGGCTATGAAGAAAGACTCGAGTCTTTCTTCATAGCCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080473.3-575s1c1
Sequence:CCGGGCCCACCTTCGTGTCCGACTTCTCGAGAAGTCGGACACGAAGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080473.3-1133s1c1
Sequence:CCGGCGGCCACTTGGAGTTCAAGTTCTCGAGAACTTGAACTCCAAGTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080473
GATA5 MISSION shRNA shRNA Plasmid DNA
GATA binding protein 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080473.4-971s21c1
Sequence:CCGGCTCAGGATCCACAAGGAATGCCTCGAGGCATTCCTTGTGGATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080473.4-1560s21c1
Sequence:CCGGACCACCACCACCAACTTGAATCTCGAGATTCAAGTTGGTGGTGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080473.4-1752s21c1
Sequence:CCGGTCATTGCCCACATGGATAGACCTCGAGGTCTATCCATGTGGGCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080473.3-938s1c1
Sequence:CCGGGAAGCCAAAGACCATCGCCAACTCGAGTTGGCGATGGTCTTTGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080473.3-896s1c1
Sequence:CCGGGCCTCTGGCTATGAAGAAAGACTCGAGTCTTTCTTCATAGCCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080473.3-575s1c1
Sequence:CCGGGCCCACCTTCGTGTCCGACTTCTCGAGAAGTCGGACACGAAGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080473.3-1133s1c1
Sequence:CCGGCGGCCACTTGGAGTTCAAGTTCTCGAGAACTTGAACTCCAAGTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080473
GATA5 MISSION shRNA Lentiviral Transduction Particles
GATA binding protein 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080473.4-971s21c1
Sequence:CCGGCTCAGGATCCACAAGGAATGCCTCGAGGCATTCCTTGTGGATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080473.4-1560s21c1
Sequence:CCGGACCACCACCACCAACTTGAATCTCGAGATTCAAGTTGGTGGTGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080473.4-1752s21c1
Sequence:CCGGTCATTGCCCACATGGATAGACCTCGAGGTCTATCCATGTGGGCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080473.3-938s1c1
Sequence:CCGGGAAGCCAAAGACCATCGCCAACTCGAGTTGGCGATGGTCTTTGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080473.3-896s1c1
Sequence:CCGGGCCTCTGGCTATGAAGAAAGACTCGAGTCTTTCTTCATAGCCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080473.3-575s1c1
Sequence:CCGGGCCCACCTTCGTGTCCGACTTCTCGAGAAGTCGGACACGAAGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080473.3-1133s1c1
Sequence:CCGGCGGCCACTTGGAGTTCAAGTTCTCGAGAACTTGAACTCCAAGTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008093
GATA5 MISSION shRNA Bacterial Glycerol Stock
GATA binding protein 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008093.2-1160s21c1
Sequence:CCGGCCAAGGCCACTGGCAATGAAACTCGAGTTTCATTGCCAGTGGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008093.2-505s21c1
Sequence:CCGGACAAGCAGTTGCCGCTGATTCCTCGAGGAATCAGCGGCAACTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008093.2-1861s21c1
Sequence:CCGGCATACTCCAGGCAGGCAATAACTCGAGTTATTGCCTGCCTGGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008093.2-1906s21c1
Sequence:CCGGCGTCTTCATTTCCCGTGTTTGCTCGAGCAAACACGGGAAATGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008093.1-2221s1c1
Sequence:CCGGGCCCTATTTGTTAGCATCTTTCTCGAGAAAGATGCTAACAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008093.1-1406s1c1
Sequence:CCGGGAGTTCAAGTTCGAACCTGAACTCGAGTTCAGGTTCGAACTTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008093.1-734s1c1
Sequence:CCGGGCATACATGAGTTCCGACGTACTCGAGTACGTCGGAACTCATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008093.1-498s1c1
Sequence:CCGGCACAAACAGTTGCCGCTGATTCTCGAGAATCAGCGGCAACTGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008093.1-938s1c1
Sequence:CCGGACCGGACACTATCTATGCAATCTCGAGATTGCATAGATAGTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008093
GATA5 MISSION shRNA shRNA Plasmid DNA
GATA binding protein 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008093.2-1160s21c1
Sequence:CCGGCCAAGGCCACTGGCAATGAAACTCGAGTTTCATTGCCAGTGGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008093.2-505s21c1
Sequence:CCGGACAAGCAGTTGCCGCTGATTCCTCGAGGAATCAGCGGCAACTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008093.2-1861s21c1
Sequence:CCGGCATACTCCAGGCAGGCAATAACTCGAGTTATTGCCTGCCTGGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008093.2-1906s21c1
Sequence:CCGGCGTCTTCATTTCCCGTGTTTGCTCGAGCAAACACGGGAAATGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008093.1-2221s1c1
Sequence:CCGGGCCCTATTTGTTAGCATCTTTCTCGAGAAAGATGCTAACAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008093.1-1406s1c1
Sequence:CCGGGAGTTCAAGTTCGAACCTGAACTCGAGTTCAGGTTCGAACTTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008093.1-734s1c1
Sequence:CCGGGCATACATGAGTTCCGACGTACTCGAGTACGTCGGAACTCATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008093.1-498s1c1
Sequence:CCGGCACAAACAGTTGCCGCTGATTCTCGAGAATCAGCGGCAACTGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008093.1-938s1c1
Sequence:CCGGACCGGACACTATCTATGCAATCTCGAGATTGCATAGATAGTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008093
GATA5 MISSION shRNA Lentiviral Transduction Particles
GATA binding protein 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008093.2-1160s21c1
Sequence:CCGGCCAAGGCCACTGGCAATGAAACTCGAGTTTCATTGCCAGTGGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008093.2-505s21c1
Sequence:CCGGACAAGCAGTTGCCGCTGATTCCTCGAGGAATCAGCGGCAACTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008093.2-1861s21c1
Sequence:CCGGCATACTCCAGGCAGGCAATAACTCGAGTTATTGCCTGCCTGGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008093.2-1906s21c1
Sequence:CCGGCGTCTTCATTTCCCGTGTTTGCTCGAGCAAACACGGGAAATGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008093.1-2221s1c1
Sequence:CCGGGCCCTATTTGTTAGCATCTTTCTCGAGAAAGATGCTAACAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008093.1-1406s1c1
Sequence:CCGGGAGTTCAAGTTCGAACCTGAACTCGAGTTCAGGTTCGAACTTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008093.1-734s1c1
Sequence:CCGGGCATACATGAGTTCCGACGTACTCGAGTACGTCGGAACTCATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008093.1-498s1c1
Sequence:CCGGCACAAACAGTTGCCGCTGATTCTCGAGAATCAGCGGCAACTGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008093.1-938s1c1
Sequence:CCGGACCGGACACTATCTATGCAATCTCGAGATTGCATAGATAGTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks