EMAIL THIS PAGE TO A FRIEND

GATA6

GATA binding protein 6

163 Gene Product Result for
UniProtKB ID: Q92908, B0YJ17, P78327
Gene ID:
Human(2627) Summary: This gene is a member of a small family of zinc finger transcription factors that play an important role in the regulation of cellular differentiation and organogenesis during vertebrate development. This gene is expressed during early embryogenesis and localizes to endo- and mesodermally derived cells during later embryogenesis and thereby plays an important role in gut, lung, and heart development. Mutations in this gene are associated with several congenital defects. [provided by RefSeq, Mar 2012]
Mouse(14465) GATA binding protein 6
Rat(29300) GATA binding protein 6
Zebrafish(58076) GATA-binding protein 6
Thale Cress(824272) GATA transcription factor 6
cow(654400) GATA binding protein 6
dog(490520) GATA binding protein 6
chicken(396390) GATA binding protein 6
sheep(100820751) GATA binding protein 6
naked mole-rat(101714646) GATA binding protein 6
domestic guinea pig(100720264) GATA binding protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005257 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010258 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010258 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010258 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005257 Rosetta Predictions human pricing
NM_019185 Rosetta Predictions rat pricing
XM_001072268 Rosetta Predictions rat pricing
NM_010258 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339285 predicted 1940
2 SASI_Hs02_00339286 predicted 2146
3 SASI_Hs02_00339287 predicted 1951
4 SASI_Hs01_00123993 predicted 1557
5 SASI_Hs01_00123994 predicted 2510
6 SASI_Hs01_00123995 predicted 1657
7 SASI_Hs02_00339288 predicted 2156
8 SASI_Hs01_00123996 predicted 1717
9 SASI_Hs01_00123998 predicted 1670
10 SASI_Hs01_00123999 predicted 2444
11 SASI_Hs01_00123992 predicted 1656
12 SASI_Hs01_00123997 predicted 1664
13 SASI_Hs01_00124000 predicted 2550
14 SASI_Hs01_00124001 predicted 2551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081425 predicted 867
2 SASI_Rn01_00081426 predicted 1055
3 SASI_Rn01_00081427 predicted 1349
4 SASI_Rn01_00081429 predicted 1461
5 SASI_Rn01_00081430 predicted 1178
6 SASI_Rn01_00081432 predicted 1472
7 SASI_Rn01_00081433 predicted 625
8 SASI_Rn01_00081434 predicted 1524
9 SASI_Rn02_00261993 predicted 1006
10 SASI_Rn02_00261994 predicted 631
11 SASI_Rn01_00081428 predicted 1349
12 SASI_Rn01_00081431 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338490 predicted 1028
2 SASI_Rn02_00338491 predicted 1261
3 SASI_Rn02_00338492 predicted 1458
4 SASI_Rn02_00338493 predicted 1752
5 SASI_Rn02_00338494 predicted 1856
6 SASI_Rn02_00338495 predicted 1581
7 SASI_Rn02_00338496 predicted 1876
8 SASI_Rn02_00338497 predicted 1923
9 SASI_Rn02_00338498 predicted 1410
10 SASI_Rn02_00338499 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086442 predicted 2345
2 SASI_Mm01_00086443 predicted 2387
3 SASI_Mm01_00086445 predicted 2130
4 SASI_Mm01_00086447 predicted 1455
5 SASI_Mm01_00086448 predicted 2496
6 SASI_Mm02_00318156 predicted 2069
7 SASI_Mm01_00086449 predicted 1216
8 SASI_Mm01_00086450 predicted 2342
9 SASI_Mm02_00318157 predicted 2452
10 SASI_Mm02_00318158 predicted 2422
11 SASI_Mm01_00086441 predicted 2076
12 SASI_Mm01_00086444 predicted 2147
13 SASI_Mm01_00086446 predicted 2198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005257
VALIDATED
GATA6 MISSION shRNA Bacterial Glycerol Stock
GATA binding protein 6
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_005257.3-503s1c1
Sequence:CCGGCTCAGTTCCTACGCTTCGCATCTCGAGATGCGAAGCGTAGGAACTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005257.3-3031s1c1
Sequence:CCGGCCTAACGGATAGCATTTGTAACTCGAGTTACAAATGCTATCCGTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005257.3-1721s1c1
Sequence:CCGGGAGGGAATTCAAACCAGGAAACTCGAGTTTCCTGGTTTGAATTCCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005257.3-1664s1c1
Sequence:CCGGGCTTGTGGACTCTACATGAAACTCGAGTTTCATGTAGAGTCCACAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005257.3-1697s1c1
Sequence:CCGGCCCAGACCACTTGCTATGAAACTCGAGTTTCATAGCAAGTGGTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1609s21c1
Sequence:CCGGCACCACAACTACCACCTTATGCTCGAGCATAAGGTGGTAGTTGTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005257.3-2143s21c1
Sequence:CCGGTGCGCTGACAGAACGTGATTCCTCGAGGAATCACGTTCTGTCAGCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-606s21c1
Sequence:CCGGTGTTCACTGACCTCGACCAAGCTCGAGCTTGGTCGAGGTCAGTGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1799s21c1
Sequence:CCGGATTCCCATGACTCCAACTTCCCTCGAGGGAAGTTGGAGTCATGGGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005257.3-2519s21c1
Sequence:CCGGTCGGTTCATGAGGTCTCTTATCTCGAGATAAGAGACCTCATGAACCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1956s21c1
Sequence:CCGGGTCAAGATGGGCTCTACATAGCTCGAGCTATGTAGAGCCCATCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1861s21c1
Sequence:CCGGCACAACACAACCTACAGCCTCCTCGAGGAGGCTGTAGGTTGTGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1587s21c1
Sequence:CCGGGATTGTCCTGTGCCAACTGTCCTCGAGGACAGTTGGCACAGGACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005257
VALIDATED
GATA6 MISSION shRNA shRNA Plasmid DNA
GATA binding protein 6
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_005257.3-503s1c1
Sequence:CCGGCTCAGTTCCTACGCTTCGCATCTCGAGATGCGAAGCGTAGGAACTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005257.3-3031s1c1
Sequence:CCGGCCTAACGGATAGCATTTGTAACTCGAGTTACAAATGCTATCCGTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005257.3-1721s1c1
Sequence:CCGGGAGGGAATTCAAACCAGGAAACTCGAGTTTCCTGGTTTGAATTCCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005257.3-1664s1c1
Sequence:CCGGGCTTGTGGACTCTACATGAAACTCGAGTTTCATGTAGAGTCCACAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005257.3-1697s1c1
Sequence:CCGGCCCAGACCACTTGCTATGAAACTCGAGTTTCATAGCAAGTGGTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1609s21c1
Sequence:CCGGCACCACAACTACCACCTTATGCTCGAGCATAAGGTGGTAGTTGTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005257.3-2143s21c1
Sequence:CCGGTGCGCTGACAGAACGTGATTCCTCGAGGAATCACGTTCTGTCAGCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-606s21c1
Sequence:CCGGTGTTCACTGACCTCGACCAAGCTCGAGCTTGGTCGAGGTCAGTGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1799s21c1
Sequence:CCGGATTCCCATGACTCCAACTTCCCTCGAGGGAAGTTGGAGTCATGGGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005257.3-2519s21c1
Sequence:CCGGTCGGTTCATGAGGTCTCTTATCTCGAGATAAGAGACCTCATGAACCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1956s21c1
Sequence:CCGGGTCAAGATGGGCTCTACATAGCTCGAGCTATGTAGAGCCCATCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1861s21c1
Sequence:CCGGCACAACACAACCTACAGCCTCCTCGAGGAGGCTGTAGGTTGTGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1587s21c1
Sequence:CCGGGATTGTCCTGTGCCAACTGTCCTCGAGGACAGTTGGCACAGGACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005257
VALIDATED
GATA6 MISSION shRNA Lentiviral Transduction Particles
GATA binding protein 6
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_005257.3-503s1c1
Sequence:CCGGCTCAGTTCCTACGCTTCGCATCTCGAGATGCGAAGCGTAGGAACTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005257.3-3031s1c1
Sequence:CCGGCCTAACGGATAGCATTTGTAACTCGAGTTACAAATGCTATCCGTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005257.3-1721s1c1
Sequence:CCGGGAGGGAATTCAAACCAGGAAACTCGAGTTTCCTGGTTTGAATTCCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005257.3-1664s1c1
Sequence:CCGGGCTTGTGGACTCTACATGAAACTCGAGTTTCATGTAGAGTCCACAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005257.3-1697s1c1
Sequence:CCGGCCCAGACCACTTGCTATGAAACTCGAGTTTCATAGCAAGTGGTCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1609s21c1
Sequence:CCGGCACCACAACTACCACCTTATGCTCGAGCATAAGGTGGTAGTTGTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005257.3-2143s21c1
Sequence:CCGGTGCGCTGACAGAACGTGATTCCTCGAGGAATCACGTTCTGTCAGCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-606s21c1
Sequence:CCGGTGTTCACTGACCTCGACCAAGCTCGAGCTTGGTCGAGGTCAGTGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1799s21c1
Sequence:CCGGATTCCCATGACTCCAACTTCCCTCGAGGGAAGTTGGAGTCATGGGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005257.3-2519s21c1
Sequence:CCGGTCGGTTCATGAGGTCTCTTATCTCGAGATAAGAGACCTCATGAACCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1956s21c1
Sequence:CCGGGTCAAGATGGGCTCTACATAGCTCGAGCTATGTAGAGCCCATCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1861s21c1
Sequence:CCGGCACAACACAACCTACAGCCTCCTCGAGGAGGCTGTAGGTTGTGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005257.3-1587s21c1
Sequence:CCGGGATTGTCCTGTGCCAACTGTCCTCGAGGACAGTTGGCACAGGACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010258
VALIDATED
GATA6 MISSION shRNA Bacterial Glycerol Stock
GATA binding protein 6
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010258.1-1607s1c1
Sequence:CCGGCCACTACCTTATGGCGTAGAACTCGAGTTCTACGCCATAAGGTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010258.1-1930s1c1
Sequence:CCGGGACCTCAAGTATTCAGGTCAACTCGAGTTGACCTGAATACTTGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010258.1-1787s1c1
Sequence:CCGGCTGTCCCTATGACTCCTACTTCTCGAGAAGTAGGAGTCATAGGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010258.1-1687s1c1
Sequence:CCGGCCTCGACCACTTGCTATGAAACTCGAGTTTCATAGCAAGTGGTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010258.1-1497s1c1
Sequence:CCGGCGGTCTCTACAGCAAGATGAACTCGAGTTCATCTTGCTGTAGAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010258.3-2409s21c1
Sequence:CCGGCTTGTGATCAACCTCGGTTATCTCGAGATAACCGAGGTTGATCACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1921s21c1
Sequence:CCGGGAACAGTGACCTCAAGTATTCCTCGAGGAATACTTGAGGTCACTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1785s21c1
Sequence:CCGGCTGTCCCTATGACTCCTACTTCTCGAGAAGTAGGAGTCATAGGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1607s21c1
Sequence:CCGGACTACCTTATGGCGTAGAAATCTCGAGATTTCTACGCCATAAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010258.3-2141s21c1
Sequence:CCGGCATTCCTTCGATGCGTGATTTCTCGAGAAATCACGCATCGAAGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1647s21c1
Sequence:CCGGGCAATGCTTGCGGGCTCTATACTCGAGTATAGAGCCCGCAAGCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1245s21c1
Sequence:CCGGATCACCATCACCCGACCTACTCTCGAGAGTAGGTCGGGTGATGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1459s21c1
Sequence:CCGGACGAGACGGCACCGGTCATTACTCGAGTAATGACCGGTGCCGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010258
VALIDATED
GATA6 MISSION shRNA shRNA Plasmid DNA
GATA binding protein 6
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010258.1-1607s1c1
Sequence:CCGGCCACTACCTTATGGCGTAGAACTCGAGTTCTACGCCATAAGGTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010258.1-1930s1c1
Sequence:CCGGGACCTCAAGTATTCAGGTCAACTCGAGTTGACCTGAATACTTGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010258.1-1787s1c1
Sequence:CCGGCTGTCCCTATGACTCCTACTTCTCGAGAAGTAGGAGTCATAGGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010258.1-1687s1c1
Sequence:CCGGCCTCGACCACTTGCTATGAAACTCGAGTTTCATAGCAAGTGGTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010258.1-1497s1c1
Sequence:CCGGCGGTCTCTACAGCAAGATGAACTCGAGTTCATCTTGCTGTAGAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010258.3-2409s21c1
Sequence:CCGGCTTGTGATCAACCTCGGTTATCTCGAGATAACCGAGGTTGATCACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1921s21c1
Sequence:CCGGGAACAGTGACCTCAAGTATTCCTCGAGGAATACTTGAGGTCACTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1785s21c1
Sequence:CCGGCTGTCCCTATGACTCCTACTTCTCGAGAAGTAGGAGTCATAGGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1607s21c1
Sequence:CCGGACTACCTTATGGCGTAGAAATCTCGAGATTTCTACGCCATAAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010258.3-2141s21c1
Sequence:CCGGCATTCCTTCGATGCGTGATTTCTCGAGAAATCACGCATCGAAGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1647s21c1
Sequence:CCGGGCAATGCTTGCGGGCTCTATACTCGAGTATAGAGCCCGCAAGCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1245s21c1
Sequence:CCGGATCACCATCACCCGACCTACTCTCGAGAGTAGGTCGGGTGATGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1459s21c1
Sequence:CCGGACGAGACGGCACCGGTCATTACTCGAGTAATGACCGGTGCCGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010258
VALIDATED
GATA6 MISSION shRNA Lentiviral Transduction Particles
GATA binding protein 6
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010258.1-1607s1c1
Sequence:CCGGCCACTACCTTATGGCGTAGAACTCGAGTTCTACGCCATAAGGTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010258.1-1930s1c1
Sequence:CCGGGACCTCAAGTATTCAGGTCAACTCGAGTTGACCTGAATACTTGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010258.1-1787s1c1
Sequence:CCGGCTGTCCCTATGACTCCTACTTCTCGAGAAGTAGGAGTCATAGGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010258.1-1687s1c1
Sequence:CCGGCCTCGACCACTTGCTATGAAACTCGAGTTTCATAGCAAGTGGTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010258.1-1497s1c1
Sequence:CCGGCGGTCTCTACAGCAAGATGAACTCGAGTTCATCTTGCTGTAGAGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010258.3-2409s21c1
Sequence:CCGGCTTGTGATCAACCTCGGTTATCTCGAGATAACCGAGGTTGATCACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1921s21c1
Sequence:CCGGGAACAGTGACCTCAAGTATTCCTCGAGGAATACTTGAGGTCACTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1785s21c1
Sequence:CCGGCTGTCCCTATGACTCCTACTTCTCGAGAAGTAGGAGTCATAGGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1607s21c1
Sequence:CCGGACTACCTTATGGCGTAGAAATCTCGAGATTTCTACGCCATAAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010258.3-2141s21c1
Sequence:CCGGCATTCCTTCGATGCGTGATTTCTCGAGAAATCACGCATCGAAGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1647s21c1
Sequence:CCGGGCAATGCTTGCGGGCTCTATACTCGAGTATAGAGCCCGCAAGCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1245s21c1
Sequence:CCGGATCACCATCACCCGACCTACTCTCGAGAGTAGGTCGGGTGATGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010258.3-1459s21c1
Sequence:CCGGACGAGACGGCACCGGTCATTACTCGAGTAATGACCGGTGCCGTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)