EMAIL THIS PAGE TO A FRIEND

GATAD1

GATA zinc finger domain containing 1

62 Gene Product Result for
Synonyms: CMD2B ODAG RG083M05.2
UniProtKB ID: Q8WUU5, B2RE37, D6W5Q5, Q8N5Y5, Q99995, Q9H689
Gene ID:
Human(57798) Summary: The protein encoded by this gene contains a zinc finger at the N-terminus, and is thought to bind to a histone modification site that regulates gene expression. Mutations in this gene have been associated with autosomal recessive dilated cardiomyopathy. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
Mouse(67210) GATA zinc finger domain containing 1
Rat(500005) GATA zinc finger domain containing 1
Zebrafish(678617) GATA zinc finger domain containing 1
dog(482301) GATA zinc finger domain containing 1
domestic cat(101086048) GATA zinc finger domain containing 1
cow(784921) GATA zinc finger domain containing 1
chicken(420551) GATA zinc finger domain containing 1
domestic guinea pig(100717763) GATA zinc finger domain containing 1
naked mole-rat(101722277) GATA zinc finger domain containing 1
sheep(101113843) GATA zinc finger domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021167 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026033 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026033 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026033 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021167 Rosetta Predictions human pricing
XM_001068512 Rosetta Predictions rat pricing
XM_575359 Rosetta Predictions rat pricing
NM_026033 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119116 predicted 764
2 SASI_Hs01_00119117 predicted 688
3 SASI_Hs01_00119118 predicted 918
4 SASI_Hs01_00119119 predicted 1074
5 SASI_Hs01_00119120 predicted 652
6 SASI_Hs01_00119121 predicted 971
7 SASI_Hs01_00119122 predicted 1063
8 SASI_Hs02_00354720 predicted 556
9 SASI_Hs02_00354721 predicted 730
10 SASI_Hs02_00354722 predicted 813
11 SASI_Hs01_00119123 predicted 930
12 SASI_Hs01_00119124 predicted 709
13 SASI_Hs01_00119125 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324755 predicted 895
2 SASI_Rn02_00324756 predicted 886
3 SASI_Rn02_00324757 predicted 1071
4 SASI_Rn02_00324758 predicted 1178
5 SASI_Rn02_00324759 predicted 1536
6 SASI_Rn02_00324760 predicted 1306
7 SASI_Rn02_00324761 predicted 1042
8 SASI_Rn02_00324762 predicted 1215
9 SASI_Rn02_00324763 predicted 1012
10 SASI_Rn02_00324764 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403536 predicted 928
2 SASI_Rn02_00403537 predicted 905
3 SASI_Rn02_00403538 predicted 1098
4 SASI_Rn02_00403539 predicted 1208
5 SASI_Rn02_00403540 predicted 1571
6 SASI_Rn02_00403541 predicted 1338
7 SASI_Rn02_00403542 predicted 1069
8 SASI_Rn02_00403543 predicted 1246
9 SASI_Rn02_00403544 predicted 1043
10 SASI_Rn02_00403545 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159821 predicted 721
2 SASI_Mm01_00159822 predicted 1124
3 SASI_Mm01_00159823 predicted 1362
4 SASI_Mm01_00159825 predicted 1131
5 SASI_Mm01_00159826 predicted 899
6 SASI_Mm01_00159827 predicted 690
7 SASI_Mm01_00159829 predicted 1070
8 SASI_Mm01_00159830 predicted 731
9 SASI_Mm02_00329517 predicted 1236
10 SASI_Mm02_00329518 predicted 679
11 SASI_Mm01_00159824 predicted 749
12 SASI_Mm01_00159828 predicted 1196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021167
GATAD1 MISSION shRNA Bacterial Glycerol Stock
GATA zinc finger domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021167.3-1255s21c1
Sequence:CCGGGATATGTCATAGGTATCTTTACTCGAGTAAAGATACCTATGACATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021167.3-1314s21c1
Sequence:CCGGTCTCCTGCTACCTAGTAATAACTCGAGTTATTACTAGGTAGCAGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021167.3-971s21c1
Sequence:CCGGAGTCACGGTCATCACCATTTCCTCGAGGAAATGGTGATGACCGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-544s1c1
Sequence:CCGGCCTGAGTCAGTTTCCACTATACTCGAGTATAGTGGAAACTGACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-925s1c1
Sequence:CCGGCCTGCAATAACAATTAAGGAACTCGAGTTCCTTAATTGTTATTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-588s1c1
Sequence:CCGGCAAGGGAGTATATTACCAAATCTCGAGATTTGGTAATATACTCCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-637s1c1
Sequence:CCGGCAAGATGGAAAGCCCTACTATCTCGAGATAGTAGGGCTTTCCATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-438s1c1
Sequence:CCGGGCTCAGAAACACTAAATACAACTCGAGTTGTATTTAGTGTTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021167
GATAD1 MISSION shRNA shRNA Plasmid DNA
GATA zinc finger domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021167.3-1255s21c1
Sequence:CCGGGATATGTCATAGGTATCTTTACTCGAGTAAAGATACCTATGACATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021167.3-1314s21c1
Sequence:CCGGTCTCCTGCTACCTAGTAATAACTCGAGTTATTACTAGGTAGCAGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021167.3-971s21c1
Sequence:CCGGAGTCACGGTCATCACCATTTCCTCGAGGAAATGGTGATGACCGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-544s1c1
Sequence:CCGGCCTGAGTCAGTTTCCACTATACTCGAGTATAGTGGAAACTGACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-925s1c1
Sequence:CCGGCCTGCAATAACAATTAAGGAACTCGAGTTCCTTAATTGTTATTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-588s1c1
Sequence:CCGGCAAGGGAGTATATTACCAAATCTCGAGATTTGGTAATATACTCCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-637s1c1
Sequence:CCGGCAAGATGGAAAGCCCTACTATCTCGAGATAGTAGGGCTTTCCATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-438s1c1
Sequence:CCGGGCTCAGAAACACTAAATACAACTCGAGTTGTATTTAGTGTTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021167
GATAD1 MISSION shRNA Lentiviral Transduction Particles
GATA zinc finger domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021167.3-1255s21c1
Sequence:CCGGGATATGTCATAGGTATCTTTACTCGAGTAAAGATACCTATGACATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021167.3-1314s21c1
Sequence:CCGGTCTCCTGCTACCTAGTAATAACTCGAGTTATTACTAGGTAGCAGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021167.3-971s21c1
Sequence:CCGGAGTCACGGTCATCACCATTTCCTCGAGGAAATGGTGATGACCGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-544s1c1
Sequence:CCGGCCTGAGTCAGTTTCCACTATACTCGAGTATAGTGGAAACTGACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-925s1c1
Sequence:CCGGCCTGCAATAACAATTAAGGAACTCGAGTTCCTTAATTGTTATTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-588s1c1
Sequence:CCGGCAAGGGAGTATATTACCAAATCTCGAGATTTGGTAATATACTCCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-637s1c1
Sequence:CCGGCAAGATGGAAAGCCCTACTATCTCGAGATAGTAGGGCTTTCCATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021167.2-438s1c1
Sequence:CCGGGCTCAGAAACACTAAATACAACTCGAGTTGTATTTAGTGTTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026033
VALIDATED
GATAD1 MISSION shRNA Bacterial Glycerol Stock
GATA zinc finger domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026033.2-978s21c1
Sequence:CCGGCACGCGCCTTCTGAGTATTTCCTCGAGGAAATACTCAGAAGGCGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026033.2-1071s21c1
Sequence:CCGGCCTACTCCTGCGATAACTATTCTCGAGAATAGTTATCGCAGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026033.2-733s21c1
Sequence:CCGGTCTTCTACAAGGGAGTATATTCTCGAGAATATACTCCCTTGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026033.2-902s21c1
Sequence:CCGGGTTTGATCCTGCATCATATATCTCGAGATATATGATGCAGGATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026033.2-1141s21c1
Sequence:CCGGTACTTACTTCGCAGGTATAAACTCGAGTTTATACCTGCGAAGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026033.1-721s1c1
Sequence:CCGGCAAGGGAGTATATTACCAAATCTCGAGATTTGGTAATATACTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026033.1-880s1c2
Sequence:CCGGCCAGTTTGATCCTGCATCATACTCGAGTATGATGCAGGATCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026033.1-752s1c1
Sequence:CCGGGTTTCTGTGATTGATGAGCAACTCGAGTTGCTCATCAATCACAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026033
VALIDATED
GATAD1 MISSION shRNA shRNA Plasmid DNA
GATA zinc finger domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026033.2-978s21c1
Sequence:CCGGCACGCGCCTTCTGAGTATTTCCTCGAGGAAATACTCAGAAGGCGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026033.2-1071s21c1
Sequence:CCGGCCTACTCCTGCGATAACTATTCTCGAGAATAGTTATCGCAGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026033.2-733s21c1
Sequence:CCGGTCTTCTACAAGGGAGTATATTCTCGAGAATATACTCCCTTGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026033.2-902s21c1
Sequence:CCGGGTTTGATCCTGCATCATATATCTCGAGATATATGATGCAGGATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026033.2-1141s21c1
Sequence:CCGGTACTTACTTCGCAGGTATAAACTCGAGTTTATACCTGCGAAGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026033.1-721s1c1
Sequence:CCGGCAAGGGAGTATATTACCAAATCTCGAGATTTGGTAATATACTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026033.1-880s1c2
Sequence:CCGGCCAGTTTGATCCTGCATCATACTCGAGTATGATGCAGGATCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026033.1-752s1c1
Sequence:CCGGGTTTCTGTGATTGATGAGCAACTCGAGTTGCTCATCAATCACAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026033
VALIDATED
GATAD1 MISSION shRNA Lentiviral Transduction Particles
GATA zinc finger domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026033.2-978s21c1
Sequence:CCGGCACGCGCCTTCTGAGTATTTCCTCGAGGAAATACTCAGAAGGCGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026033.2-1071s21c1
Sequence:CCGGCCTACTCCTGCGATAACTATTCTCGAGAATAGTTATCGCAGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026033.2-733s21c1
Sequence:CCGGTCTTCTACAAGGGAGTATATTCTCGAGAATATACTCCCTTGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026033.2-902s21c1
Sequence:CCGGGTTTGATCCTGCATCATATATCTCGAGATATATGATGCAGGATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026033.2-1141s21c1
Sequence:CCGGTACTTACTTCGCAGGTATAAACTCGAGTTTATACCTGCGAAGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026033.1-721s1c1
Sequence:CCGGCAAGGGAGTATATTACCAAATCTCGAGATTTGGTAATATACTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026033.1-880s1c2
Sequence:CCGGCCAGTTTGATCCTGCATCATACTCGAGTATGATGCAGGATCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026033.1-752s1c1
Sequence:CCGGGTTTCTGTGATTGATGAGCAACTCGAGTTGCTCATCAATCACAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks