EMAIL THIS PAGE TO A FRIEND

GATAD2A

GATA zinc finger domain containing 2A

73 Gene Product Result for
Synonyms: p66alpha
UniProtKB ID: Q86YP4, Q7L3J2, Q96F28, Q9NPU2, Q9NXS1
Gene ID:
Mouse(234366) GATA zinc finger domain containing 2A
Rat(290669) GATA zinc finger domain containing 2A
sheep(101105075) GATA zinc finger domain containing 2A
Domestic Rabbit(100346172) GATA zinc finger domain containing 2A
naked mole-rat(101717557) GATA zinc finger domain containing 2A
domestic guinea pig(100718838) GATA zinc finger domain containing 2A
chicken(420109) GATA zinc finger domain containing 2A
domestic cat(101099695) GATA zinc finger domain containing 2A
Horse(100071147) GATA zinc finger domain containing 2A
cow(508384) GATA zinc finger domain containing 2A
dog(484806) GATA zinc finger domain containing 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017660 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145596 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145596 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145596 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017660 Rosetta Predictions human pricing
NM_001013881 Rosetta Predictions rat pricing
NM_001113345 Rosetta Predictions mouse pricing
NM_001113346 Rosetta Predictions mouse pricing
NM_145596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028195 predicted 1794
2 SASI_Hs01_00028196 predicted 2434
3 SASI_Hs01_00028197 predicted 1934
4 SASI_Hs01_00028199 predicted 2402
5 SASI_Hs02_00350376 predicted 578
6 SASI_Hs01_00028200 predicted 1824
7 SASI_Hs01_00028201 predicted 2467
8 SASI_Hs01_00028202 predicted 2359
9 SASI_Hs01_00028203 predicted 1672
10 SASI_Hs02_00350377 predicted 412
11 SASI_Hs01_00028198 predicted 486
12 SASI_Hs01_00028204 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071066 predicted 514
2 SASI_Rn01_00071067 predicted 856
3 SASI_Rn01_00071068 predicted 1005
4 SASI_Rn01_00071069 predicted 484
5 SASI_Rn01_00071070 predicted 844
6 SASI_Rn01_00071071 predicted 448
7 SASI_Rn01_00071072 predicted 735
8 SASI_Rn01_00071073 predicted 754
9 SASI_Rn01_00071074 predicted 1461
10 SASI_Rn01_00071075 predicted 1689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113345 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307403 predicted 2404
2 SASI_Mm02_00307404 predicted 2362
3 SASI_Mm02_00307405 predicted 830
4 SASI_Mm02_00307406 predicted 1658
5 SASI_Mm02_00307407 predicted 1712
6 SASI_Mm02_00307408 predicted 2039
7 SASI_Mm02_00307409 predicted 1786
8 SASI_Mm02_00307410 predicted 1813
9 SASI_Mm02_00307411 predicted 2362
10 SASI_Mm02_00307412 predicted 2176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307413 predicted 2264
2 SASI_Mm02_00307414 predicted 2223
3 SASI_Mm02_00307415 predicted 684
4 SASI_Mm02_00307416 predicted 1515
5 SASI_Mm02_00307417 predicted 1575
6 SASI_Mm02_00307418 predicted 1899
7 SASI_Mm02_00307419 predicted 1648
8 SASI_Mm02_00307420 predicted 1676
9 SASI_Mm02_00307421 predicted 2226
10 SASI_Mm02_00307422 predicted 2040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165734 predicted 2412
2 SASI_Mm02_00341134 predicted 2369
3 SASI_Mm01_00165735 predicted 830
4 SASI_Mm01_00165737 predicted 1665
5 SASI_Mm01_00165738 predicted 1717
6 SASI_Mm01_00165739 predicted 2049
7 SASI_Mm01_00165742 predicted 1791
8 SASI_Mm02_00341135 predicted 1825
9 SASI_Mm02_00341136 predicted 2372
10 SASI_Mm02_00341137 predicted 2185
11 SASI_Mm01_00165736 predicted 1383
12 SASI_Mm01_00165740 predicted 558
13 SASI_Mm01_00165741 predicted 1283
14 SASI_Mm01_00165743 predicted 1155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017660
VALIDATED
GATAD2A MISSION shRNA Bacterial Glycerol Stock
GATA zinc finger domain containing 2A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_017660.2-1224s1c1
Sequence:CCGGCAGAACCTACTGGAGACACAACTCGAGTTGTGTCTCCAGTAGGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017660.2-535s1c1
Sequence:CCGGTGCGGCAGAGTCAAATACAAACTCGAGTTTGTATTTGACTCTGCCGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017660.2-1819s1c1
Sequence:CCGGCCCTTGCGTTTGTCAGCCCAACTCGAGTTGGGCTGACAAACGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017660.3-1064s21c1
Sequence:GTACCGGCTCAGCAAATCCACAGCATTACTCGAGTAATGCTGTGGATTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017660.3-730s21c1
Sequence:GTACCGGGAACGAGAAAGGATGATCAAGCTCGAGCTTGATCATCCTTTCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017660.3-2683s21c1
Sequence:CCGGGCCTTCCCATGGCGATCTATACTCGAGTATAGATCGCCATGGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017660.3-413s21c1
Sequence:CCGGGATTGTTGGCTTCAGATTTAACTCGAGTTAAATCTGAAGCCAACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017660.3-720s21c1
Sequence:CCGGCAGTCCTGAAGAACGAGAAAGCTCGAGCTTTCTCGTTCTTCAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017660.3-806s21c1
Sequence:CCGGTGCGGCAGAGTCAAATACAAACTCGAGTTTGTATTTGACTCTGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_017660.3-1800s21c1
Sequence:CCGGCGTGCTGAAGCAGGTCATAAACTCGAGTTTATGACCTGCTTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017660
VALIDATED
GATAD2A MISSION shRNA shRNA Plasmid DNA
GATA zinc finger domain containing 2A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_017660.2-1224s1c1
Sequence:CCGGCAGAACCTACTGGAGACACAACTCGAGTTGTGTCTCCAGTAGGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017660.2-535s1c1
Sequence:CCGGTGCGGCAGAGTCAAATACAAACTCGAGTTTGTATTTGACTCTGCCGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017660.2-1819s1c1
Sequence:CCGGCCCTTGCGTTTGTCAGCCCAACTCGAGTTGGGCTGACAAACGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017660.3-1064s21c1
Sequence:GTACCGGCTCAGCAAATCCACAGCATTACTCGAGTAATGCTGTGGATTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017660.3-730s21c1
Sequence:GTACCGGGAACGAGAAAGGATGATCAAGCTCGAGCTTGATCATCCTTTCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017660.3-2683s21c1
Sequence:CCGGGCCTTCCCATGGCGATCTATACTCGAGTATAGATCGCCATGGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017660.3-413s21c1
Sequence:CCGGGATTGTTGGCTTCAGATTTAACTCGAGTTAAATCTGAAGCCAACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017660.3-720s21c1
Sequence:CCGGCAGTCCTGAAGAACGAGAAAGCTCGAGCTTTCTCGTTCTTCAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017660.3-806s21c1
Sequence:CCGGTGCGGCAGAGTCAAATACAAACTCGAGTTTGTATTTGACTCTGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_017660.3-1800s21c1
Sequence:CCGGCGTGCTGAAGCAGGTCATAAACTCGAGTTTATGACCTGCTTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017660
VALIDATED
GATAD2A MISSION shRNA Lentiviral Transduction Particles
GATA zinc finger domain containing 2A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_017660.2-1224s1c1
Sequence:CCGGCAGAACCTACTGGAGACACAACTCGAGTTGTGTCTCCAGTAGGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017660.2-535s1c1
Sequence:CCGGTGCGGCAGAGTCAAATACAAACTCGAGTTTGTATTTGACTCTGCCGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017660.2-1819s1c1
Sequence:CCGGCCCTTGCGTTTGTCAGCCCAACTCGAGTTGGGCTGACAAACGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017660.3-1064s21c1
Sequence:GTACCGGCTCAGCAAATCCACAGCATTACTCGAGTAATGCTGTGGATTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017660.3-730s21c1
Sequence:GTACCGGGAACGAGAAAGGATGATCAAGCTCGAGCTTGATCATCCTTTCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017660.3-2683s21c1
Sequence:CCGGGCCTTCCCATGGCGATCTATACTCGAGTATAGATCGCCATGGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017660.3-413s21c1
Sequence:CCGGGATTGTTGGCTTCAGATTTAACTCGAGTTAAATCTGAAGCCAACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017660.3-720s21c1
Sequence:CCGGCAGTCCTGAAGAACGAGAAAGCTCGAGCTTTCTCGTTCTTCAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017660.3-806s21c1
Sequence:CCGGTGCGGCAGAGTCAAATACAAACTCGAGTTTGTATTTGACTCTGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_017660.3-1800s21c1
Sequence:CCGGCGTGCTGAAGCAGGTCATAAACTCGAGTTTATGACCTGCTTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145596
VALIDATED
GATAD2A MISSION shRNA Bacterial Glycerol Stock
GATA zinc finger domain containing 2A
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145596.2-3581s1c1
Sequence:CCGGCCTCCTAATAAAGGCTCATTTCTCGAGAAATGAGCCTTTATTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145596.2-1902s1c1
Sequence:CCGGGCCGCCTTTGTGAAGGCTCTACTCGAGTAGAGCCTTCACAAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145596.2-565s1c1
Sequence:CCGGGCACCCTTGAACCTGACCTAACTCGAGTTAGGTCAGGTTCAAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145596.2-1648s1c1
Sequence:CCGGGTGCTGCCAATAATGAGTTTACTCGAGTAAACTCATTATTGGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145596.2-1267s1c1
Sequence:CCGGCCCAGCAGATTCACAACATCACTCGAGTGATGTTGTGAATCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145596.3-1661s21c1
Sequence:CCGGGTGCTGCCAATAATGAGTTTACTCGAGTAAACTCATTATTGGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-1150s21c1
Sequence:CCGGCAGACCTCCTCCACTCGAATACTCGAGTATTCGAGTGGAGGAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-1383s21c1
Sequence:CCGGGATCATCCAGCAGGGACTTATCTCGAGATAAGTCCCTGCTGGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-2814s21c1
Sequence:CCGGGCCTCTTCATGGCCATCTATACTCGAGTATAGATGGCCATGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-1484s21c1
Sequence:CCGGTTGCTTCTGCTCAGGCAAATTCTCGAGAATTTGCCTGAGCAGAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-2412s21c1
Sequence:CCGGCCAATCAGCCACATGGAAATACTCGAGTATTTCCATGTGGCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145596
VALIDATED
GATAD2A MISSION shRNA shRNA Plasmid DNA
GATA zinc finger domain containing 2A
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145596.2-3581s1c1
Sequence:CCGGCCTCCTAATAAAGGCTCATTTCTCGAGAAATGAGCCTTTATTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145596.2-1902s1c1
Sequence:CCGGGCCGCCTTTGTGAAGGCTCTACTCGAGTAGAGCCTTCACAAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145596.2-565s1c1
Sequence:CCGGGCACCCTTGAACCTGACCTAACTCGAGTTAGGTCAGGTTCAAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145596.2-1648s1c1
Sequence:CCGGGTGCTGCCAATAATGAGTTTACTCGAGTAAACTCATTATTGGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145596.2-1267s1c1
Sequence:CCGGCCCAGCAGATTCACAACATCACTCGAGTGATGTTGTGAATCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145596.3-1661s21c1
Sequence:CCGGGTGCTGCCAATAATGAGTTTACTCGAGTAAACTCATTATTGGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-1150s21c1
Sequence:CCGGCAGACCTCCTCCACTCGAATACTCGAGTATTCGAGTGGAGGAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-1383s21c1
Sequence:CCGGGATCATCCAGCAGGGACTTATCTCGAGATAAGTCCCTGCTGGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-2814s21c1
Sequence:CCGGGCCTCTTCATGGCCATCTATACTCGAGTATAGATGGCCATGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-1484s21c1
Sequence:CCGGTTGCTTCTGCTCAGGCAAATTCTCGAGAATTTGCCTGAGCAGAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-2412s21c1
Sequence:CCGGCCAATCAGCCACATGGAAATACTCGAGTATTTCCATGTGGCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145596
VALIDATED
GATAD2A MISSION shRNA Lentiviral Transduction Particles
GATA zinc finger domain containing 2A
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145596.2-3581s1c1
Sequence:CCGGCCTCCTAATAAAGGCTCATTTCTCGAGAAATGAGCCTTTATTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145596.2-1902s1c1
Sequence:CCGGGCCGCCTTTGTGAAGGCTCTACTCGAGTAGAGCCTTCACAAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145596.2-565s1c1
Sequence:CCGGGCACCCTTGAACCTGACCTAACTCGAGTTAGGTCAGGTTCAAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145596.2-1648s1c1
Sequence:CCGGGTGCTGCCAATAATGAGTTTACTCGAGTAAACTCATTATTGGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145596.2-1267s1c1
Sequence:CCGGCCCAGCAGATTCACAACATCACTCGAGTGATGTTGTGAATCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145596.3-1661s21c1
Sequence:CCGGGTGCTGCCAATAATGAGTTTACTCGAGTAAACTCATTATTGGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-1150s21c1
Sequence:CCGGCAGACCTCCTCCACTCGAATACTCGAGTATTCGAGTGGAGGAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-1383s21c1
Sequence:CCGGGATCATCCAGCAGGGACTTATCTCGAGATAAGTCCCTGCTGGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-2814s21c1
Sequence:CCGGGCCTCTTCATGGCCATCTATACTCGAGTATAGATGGCCATGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-1484s21c1
Sequence:CCGGTTGCTTCTGCTCAGGCAAATTCTCGAGAATTTGCCTGAGCAGAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145596.3-2412s21c1
Sequence:CCGGCCAATCAGCCACATGGAAATACTCGAGTATTTCCATGTGGCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks