EMAIL THIS PAGE TO A FRIEND

GATAD2B

GATA zinc finger domain containing 2B

260 Gene Product Result for
Synonyms: MRD18 P66beta RP11-216N14.6 p68
UniProtKB ID: Q8WXI9, D3DUZ2, Q5VUR2, Q7LG68, Q9ULS0
Gene ID:
Mouse(229542) GATA zinc finger domain containing 2B
Rat(310614) GATA zinc finger domain containing 2B
Zebrafish(562045) GATA zinc finger domain containing 2B
domestic cat(101101359) GATA zinc finger domain containing 2B
Horse(100062097) GATA zinc finger domain containing 2B
dog(490453) GATA zinc finger domain containing 2B
chicken(426098) GATA zinc finger domain containing 2B
cow(505039) GATA zinc finger domain containing 2B
domestic guinea pig(100726865) GATA zinc finger domain containing 2B
naked mole-rat(101710949) GATA zinc finger domain containing 2B
sheep(101106983) GATA zinc finger domain containing 2B
Domestic Rabbit(100339574) GATA zinc finger domain containing 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139304 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139304 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139304 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020699 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020699 Rosetta Predictions human pricing
NM_001024888 Rosetta Predictions rat pricing
NM_139304 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213688 predicted 856
2 SASI_Hs02_00353693 predicted 1438
3 SASI_Hs01_00213689 predicted 1112
4 SASI_Hs01_00213690 predicted 1295
5 SASI_Hs01_00213691 predicted 1012
6 SASI_Hs01_00213692 predicted 597
7 SASI_Hs01_00213693 predicted 1019
8 SASI_Hs01_00213696 predicted 1550
9 SASI_Hs02_00353694 predicted 1393
10 SASI_Hs01_00213697 predicted 1127
11 SASI_Hs01_00213694 predicted 768
12 SASI_Hs01_00213695 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038747 predicted 815
2 SASI_Rn01_00038748 predicted 1506
3 SASI_Rn01_00038749 predicted 349
4 SASI_Rn01_00038750 predicted 771
5 SASI_Rn01_00038751 predicted 1245
6 SASI_Rn01_00038752 predicted 968
7 SASI_Rn01_00038753 predicted 1847
8 SASI_Rn01_00038754 predicted 685
9 SASI_Rn02_00202783 predicted 613
10 SASI_Rn01_00038755 predicted 418
11 SASI_Rn01_00038756 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051499 predicted 630
2 SASI_Mm01_00051500 predicted 1315
3 SASI_Mm01_00051501 predicted 1066
4 SASI_Mm01_00051502 predicted 776
5 SASI_Mm01_00051503 predicted 1441
6 SASI_Mm01_00051504 predicted 497
7 SASI_Mm01_00051505 predicted 1656
8 SASI_Mm02_00339998 predicted 216
9 SASI_Mm01_00051506 predicted 429
10 SASI_Mm01_00051507 predicted 1208
11 SASI_Mm01_00051508 predicted 709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139304
VALIDATED
GATAD2B MISSION shRNA Bacterial Glycerol Stock
GATA zinc finger domain containing 2B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-1428s21c1
Sequence:CCGGACAGGAAATTGAACAGCGATTCTCGAGAATCGCTGTTCAATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-186s21c1
Sequence:CCGGGCCGCATGAGTTACCTACTAACTCGAGTTAGTAGGTAACTCATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-433s21c1
Sequence:CCGGCGGATGGAAGAGAGACTCAAACTCGAGTTTGAGTCTCTCTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-1656s21c1
Sequence:CCGGGCCAGGTGTCAACATTGCATACTCGAGTATGCAATGTTGACACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-798s21c1
Sequence:CCGGTCAACGTGTTATTGCACCAAACTCGAGTTTGGTGCAATAACACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139304.1-1656s1c1
Sequence:CCGGGCCAGGTGTCAACATTGCATACTCGAGTATGCAATGTTGACACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139304.1-798s1c1
Sequence:CCGGTCAACGTGTTATTGCACCAAACTCGAGTTTGGTGCAATAACACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139304.1-433s1c1
Sequence:CCGGCGGATGGAAGAGAGACTCAAACTCGAGTTTGAGTCTCTCTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139304.1-186s1c1
Sequence:CCGGGCCGCATGAGTTACCTACTAACTCGAGTTAGTAGGTAACTCATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139304.1-1428s1c1
Sequence:CCGGACAGGAAATTGAACAGCGATTCTCGAGAATCGCTGTTCAATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139304
VALIDATED
GATAD2B MISSION shRNA shRNA Plasmid DNA
GATA zinc finger domain containing 2B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-1428s21c1
Sequence:CCGGACAGGAAATTGAACAGCGATTCTCGAGAATCGCTGTTCAATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-186s21c1
Sequence:CCGGGCCGCATGAGTTACCTACTAACTCGAGTTAGTAGGTAACTCATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-433s21c1
Sequence:CCGGCGGATGGAAGAGAGACTCAAACTCGAGTTTGAGTCTCTCTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-1656s21c1
Sequence:CCGGGCCAGGTGTCAACATTGCATACTCGAGTATGCAATGTTGACACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-798s21c1
Sequence:CCGGTCAACGTGTTATTGCACCAAACTCGAGTTTGGTGCAATAACACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139304.1-1656s1c1
Sequence:CCGGGCCAGGTGTCAACATTGCATACTCGAGTATGCAATGTTGACACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139304.1-798s1c1
Sequence:CCGGTCAACGTGTTATTGCACCAAACTCGAGTTTGGTGCAATAACACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139304.1-433s1c1
Sequence:CCGGCGGATGGAAGAGAGACTCAAACTCGAGTTTGAGTCTCTCTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139304.1-186s1c1
Sequence:CCGGGCCGCATGAGTTACCTACTAACTCGAGTTAGTAGGTAACTCATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139304.1-1428s1c1
Sequence:CCGGACAGGAAATTGAACAGCGATTCTCGAGAATCGCTGTTCAATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139304
VALIDATED
GATAD2B MISSION shRNA Lentiviral Transduction Particles
GATA zinc finger domain containing 2B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-1428s21c1
Sequence:CCGGACAGGAAATTGAACAGCGATTCTCGAGAATCGCTGTTCAATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-186s21c1
Sequence:CCGGGCCGCATGAGTTACCTACTAACTCGAGTTAGTAGGTAACTCATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-433s21c1
Sequence:CCGGCGGATGGAAGAGAGACTCAAACTCGAGTTTGAGTCTCTCTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-1656s21c1
Sequence:CCGGGCCAGGTGTCAACATTGCATACTCGAGTATGCAATGTTGACACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139304.1-798s21c1
Sequence:CCGGTCAACGTGTTATTGCACCAAACTCGAGTTTGGTGCAATAACACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139304.1-1656s1c1
Sequence:CCGGGCCAGGTGTCAACATTGCATACTCGAGTATGCAATGTTGACACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139304.1-798s1c1
Sequence:CCGGTCAACGTGTTATTGCACCAAACTCGAGTTTGGTGCAATAACACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139304.1-433s1c1
Sequence:CCGGCGGATGGAAGAGAGACTCAAACTCGAGTTTGAGTCTCTCTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139304.1-186s1c1
Sequence:CCGGGCCGCATGAGTTACCTACTAACTCGAGTTAGTAGGTAACTCATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139304.1-1428s1c1
Sequence:CCGGACAGGAAATTGAACAGCGATTCTCGAGAATCGCTGTTCAATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020699
VALIDATED
GATAD2B MISSION shRNA Bacterial Glycerol Stock
GATA zinc finger domain containing 2B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020699.2-6061s21c1
Sequence:CCGGCTGATTGCATCAGCATATATACTCGAGTATATATGCTGATGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020699.2-1022s21c1
Sequence:CCGGTTGATGTCTCAACGTGTTATTCTCGAGAATAACACGTTGAGACATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020699.2-1662s21c1
Sequence:GTACCGGAGGAAATTGAACAGCGATTACCTCGAGGTAATCGCTGTTCAATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020699.2-984s21c1
Sequence:CCGGTCATCCGTTCAGCTACCAATACTCGAGTATTGGTAGCTGAACGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020699.2-775s21c1
Sequence:CCGGAGCCCGACTGGTCCTGTTAAACTCGAGTTTAACAGGACCAGTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_020699.1-459s1c1
Sequence:CCGGGCAGCCAACTTAGAGATGTTTCTCGAGAAACATCTCTAAGTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020699.1-195s1c1
Sequence:CCGGCCACATGAGTTACCCACCAAACTCGAGTTTGGTGGGTAACTCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020699.1-961s1c1
Sequence:CCGGCCATCTATATGAACCTTGCTTCTCGAGAAGCAAGGTTCATATAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_020699.1-1434s1c1
Sequence:CCGGCAGGAAATTGAACAGCGATTACTCGAGTAATCGCTGTTCAATTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_020699.1-1596s1c1
Sequence:CCGGCGCTCCATGCTTTCAAACTTTCTCGAGAAAGTTTGAAAGCATGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020699
VALIDATED
GATAD2B MISSION shRNA shRNA Plasmid DNA
GATA zinc finger domain containing 2B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020699.2-6061s21c1
Sequence:CCGGCTGATTGCATCAGCATATATACTCGAGTATATATGCTGATGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020699.2-1022s21c1
Sequence:CCGGTTGATGTCTCAACGTGTTATTCTCGAGAATAACACGTTGAGACATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020699.2-1662s21c1
Sequence:GTACCGGAGGAAATTGAACAGCGATTACCTCGAGGTAATCGCTGTTCAATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020699.2-984s21c1
Sequence:CCGGTCATCCGTTCAGCTACCAATACTCGAGTATTGGTAGCTGAACGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020699.2-775s21c1
Sequence:CCGGAGCCCGACTGGTCCTGTTAAACTCGAGTTTAACAGGACCAGTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_020699.1-459s1c1
Sequence:CCGGGCAGCCAACTTAGAGATGTTTCTCGAGAAACATCTCTAAGTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020699.1-195s1c1
Sequence:CCGGCCACATGAGTTACCCACCAAACTCGAGTTTGGTGGGTAACTCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020699.1-961s1c1
Sequence:CCGGCCATCTATATGAACCTTGCTTCTCGAGAAGCAAGGTTCATATAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_020699.1-1434s1c1
Sequence:CCGGCAGGAAATTGAACAGCGATTACTCGAGTAATCGCTGTTCAATTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_020699.1-1596s1c1
Sequence:CCGGCGCTCCATGCTTTCAAACTTTCTCGAGAAAGTTTGAAAGCATGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020699
VALIDATED
GATAD2B MISSION shRNA Lentiviral Transduction Particles
GATA zinc finger domain containing 2B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020699.2-6061s21c1
Sequence:CCGGCTGATTGCATCAGCATATATACTCGAGTATATATGCTGATGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020699.2-1022s21c1
Sequence:CCGGTTGATGTCTCAACGTGTTATTCTCGAGAATAACACGTTGAGACATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020699.2-1662s21c1
Sequence:GTACCGGAGGAAATTGAACAGCGATTACCTCGAGGTAATCGCTGTTCAATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020699.2-984s21c1
Sequence:CCGGTCATCCGTTCAGCTACCAATACTCGAGTATTGGTAGCTGAACGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020699.2-775s21c1
Sequence:CCGGAGCCCGACTGGTCCTGTTAAACTCGAGTTTAACAGGACCAGTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_020699.1-459s1c1
Sequence:CCGGGCAGCCAACTTAGAGATGTTTCTCGAGAAACATCTCTAAGTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020699.1-195s1c1
Sequence:CCGGCCACATGAGTTACCCACCAAACTCGAGTTTGGTGGGTAACTCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020699.1-961s1c1
Sequence:CCGGCCATCTATATGAACCTTGCTTCTCGAGAAGCAAGGTTCATATAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_020699.1-1434s1c1
Sequence:CCGGCAGGAAATTGAACAGCGATTACTCGAGTAATCGCTGTTCAATTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_020699.1-1596s1c1
Sequence:CCGGCGCTCCATGCTTTCAAACTTTCTCGAGAAAGTTTGAAAGCATGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks