EMAIL THIS PAGE TO A FRIEND

GATC

glutamyl-tRNA(Gln) amidotransferase, subunit C

54 Gene Product Result for
Synonyms: 15E1.2
UniProtKB ID: O43716, B3KSU7, Q3B824, Q3KNR8
Gene ID:
Mouse(384281) glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial)
Rat(360821) glutamyl-tRNA(Gln) amidotransferase, subunit C
chicken(416976) glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial)
domestic cat(101096266) glutamyl-tRNA(Gln) amidotransferase, subunit C
cow(615845) glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial)
dog(477509) glutamyl-tRNA(Gln) amidotransferase, subunit C
naked mole-rat(101696840) glutamyl-tRNA(Gln) amidotransferase, subunit C
domestic guinea pig(100733550) glutamyl-tRNA(Gln) amidotransferase, subunit C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_357540 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_357540 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_357540 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_029645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_176818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176818 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176818 Rosetta Predictions human pricing
NM_001108339 Rosetta Predictions rat pricing
XM_341095 Rosetta Predictions rat pricing
NM_029645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026971 predicted 121
2 SASI_Hs01_00026972 predicted 85
3 SASI_Hs01_00026973 predicted 283
4 SASI_Hs01_00026974 predicted 260
5 SASI_Hs01_00026975 predicted 288
6 SASI_Hs01_00026978 predicted 285
7 SASI_Hs02_00369243 predicted 243
8 SASI_Hs01_00026979 predicted 249
9 SASI_Hs01_00026980 predicted 273
10 SASI_Hs02_00369244 predicted 61
11 SASI_Hs01_00026976 predicted 299
12 SASI_Hs01_00026977 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237689 predicted 517
2 SASI_Rn02_00237690 predicted 419
3 SASI_Rn02_00237691 predicted 449
4 SASI_Rn02_00237692 predicted 510
5 SASI_Rn02_00237693 predicted 382
6 SASI_Rn02_00237694 predicted 352
7 SASI_Rn02_00237695 predicted 505
8 SASI_Rn02_00237696 predicted 357
9 SASI_Rn02_00237697 predicted 354
10 SASI_Rn02_00237698 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166355 predicted 513
2 SASI_Rn01_00166356 predicted 409
3 SASI_Rn01_00166357 predicted 500
4 SASI_Rn01_00166358 predicted 382
5 SASI_Rn01_00166359 predicted 358
6 SASI_Rn01_00166360 predicted 496
7 SASI_Rn01_00166361 predicted 363
8 SASI_Rn01_00166362 predicted 352
9 SASI_Rn01_00166363 predicted 375
10 SASI_Rn01_00166364 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042055 predicted 383
2 SASI_Mm01_00042056 predicted 319
3 SASI_Mm01_00042057 predicted 507
4 SASI_Mm01_00042058 predicted 320
5 SASI_Mm01_00042059 predicted 387
6 SASI_Mm01_00042060 predicted 321
7 SASI_Mm01_00042062 predicted 559
8 SASI_Mm01_00042063 predicted 535
9 SASI_Mm02_00335638 predicted 315
10 SASI_Mm01_00042064 predicted 757
11 SASI_Mm01_00042061 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_357540
VALIDATED
GATC MISSION shRNA Bacterial Glycerol Stock
glutamyl-tRNA(Gln) amidotransferase, subunit C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357540.1-180s1c1
Sequence:CCGGCAAAGCGAATCCACAGGGAAACTCGAGTTTCCCTGTGGATTCGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357540.1-427s1c1
Sequence:CCGGCTCTACTTGAGATCTGACAATCTCGAGATTGTCAGATCTCAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357540.1-169s1c1
Sequence:CCGGAGCTTTGCTTCCAAAGCGAATCTCGAGATTCGCTTTGGAAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357540.1-411s1c1
Sequence:CCGGACTGGAGGACAGATGTCTCTACTCGAGTAGAGACATCTGTCCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357540.1-337s1c1
Sequence:CCGGCTAGAGAAAGCCATCGCCTTTCTCGAGAAAGGCGATGGCTTTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_357540
VALIDATED
GATC MISSION shRNA shRNA Plasmid DNA
glutamyl-tRNA(Gln) amidotransferase, subunit C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357540.1-180s1c1
Sequence:CCGGCAAAGCGAATCCACAGGGAAACTCGAGTTTCCCTGTGGATTCGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357540.1-427s1c1
Sequence:CCGGCTCTACTTGAGATCTGACAATCTCGAGATTGTCAGATCTCAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357540.1-169s1c1
Sequence:CCGGAGCTTTGCTTCCAAAGCGAATCTCGAGATTCGCTTTGGAAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357540.1-411s1c1
Sequence:CCGGACTGGAGGACAGATGTCTCTACTCGAGTAGAGACATCTGTCCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357540.1-337s1c1
Sequence:CCGGCTAGAGAAAGCCATCGCCTTTCTCGAGAAAGGCGATGGCTTTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_357540
VALIDATED
GATC MISSION shRNA Lentiviral Transduction Particles
glutamyl-tRNA(Gln) amidotransferase, subunit C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357540.1-180s1c1
Sequence:CCGGCAAAGCGAATCCACAGGGAAACTCGAGTTTCCCTGTGGATTCGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357540.1-427s1c1
Sequence:CCGGCTCTACTTGAGATCTGACAATCTCGAGATTGTCAGATCTCAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357540.1-169s1c1
Sequence:CCGGAGCTTTGCTTCCAAAGCGAATCTCGAGATTCGCTTTGGAAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357540.1-411s1c1
Sequence:CCGGACTGGAGGACAGATGTCTCTACTCGAGTAGAGACATCTGTCCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357540.1-337s1c1
Sequence:CCGGCTAGAGAAAGCCATCGCCTTTCTCGAGAAAGGCGATGGCTTTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029645
VALIDATED
GATC MISSION shRNA Bacterial Glycerol Stock
glutamyl-tRNA(Gln) amidotransferase, subunit C
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-392s21c1
Sequence:CCGGACGTTGTGGAGGAATACTTTGCTCGAGCAAAGTATTCCTCCACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-465s21c1
Sequence:CCGGTTCCACAGCAGAGTAGCTATTCTCGAGAATAGCTACTCTGCTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-543s21c1
Sequence:CCGGGTGAACTCTATCTAGTATAAACTCGAGTTTATACTAGATAGAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-360s21c1
Sequence:CCGGCTGTGCTGAAGAACTACTACACTCGAGTGTAGTAGTTCTTCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-516s21c1
Sequence:CCGGGACTCACAAGGGTGGTCATTTCTCGAGAAATGACCACCCTTGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-440s21c1
Sequence:CCGGCAGACATGGTAAACAAGATTCCTCGAGGAATCTTGTTTACCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-173s21c1
Sequence:CCGGTAATCGAGCATCTGGAGCGACCTCGAGGTCGCTCCAGATGCTCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029645
VALIDATED
GATC MISSION shRNA shRNA Plasmid DNA
glutamyl-tRNA(Gln) amidotransferase, subunit C
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-392s21c1
Sequence:CCGGACGTTGTGGAGGAATACTTTGCTCGAGCAAAGTATTCCTCCACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-465s21c1
Sequence:CCGGTTCCACAGCAGAGTAGCTATTCTCGAGAATAGCTACTCTGCTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-543s21c1
Sequence:CCGGGTGAACTCTATCTAGTATAAACTCGAGTTTATACTAGATAGAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-360s21c1
Sequence:CCGGCTGTGCTGAAGAACTACTACACTCGAGTGTAGTAGTTCTTCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-516s21c1
Sequence:CCGGGACTCACAAGGGTGGTCATTTCTCGAGAAATGACCACCCTTGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-440s21c1
Sequence:CCGGCAGACATGGTAAACAAGATTCCTCGAGGAATCTTGTTTACCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-173s21c1
Sequence:CCGGTAATCGAGCATCTGGAGCGACCTCGAGGTCGCTCCAGATGCTCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029645
VALIDATED
GATC MISSION shRNA Lentiviral Transduction Particles
glutamyl-tRNA(Gln) amidotransferase, subunit C
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-392s21c1
Sequence:CCGGACGTTGTGGAGGAATACTTTGCTCGAGCAAAGTATTCCTCCACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-465s21c1
Sequence:CCGGTTCCACAGCAGAGTAGCTATTCTCGAGAATAGCTACTCTGCTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-543s21c1
Sequence:CCGGGTGAACTCTATCTAGTATAAACTCGAGTTTATACTAGATAGAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-360s21c1
Sequence:CCGGCTGTGCTGAAGAACTACTACACTCGAGTGTAGTAGTTCTTCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-516s21c1
Sequence:CCGGGACTCACAAGGGTGGTCATTTCTCGAGAAATGACCACCCTTGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-440s21c1
Sequence:CCGGCAGACATGGTAAACAAGATTCCTCGAGGAATCTTGTTTACCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029645.3-173s21c1
Sequence:CCGGTAATCGAGCATCTGGAGCGACCTCGAGGTCGCTCCAGATGCTCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176818
VALIDATED
GATC MISSION shRNA Bacterial Glycerol Stock
glutamyl-tRNA(Gln) amidotransferase, subunit C
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000234607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_176818.1-109s21c1
Sequence:CCGGATCGAGCACCTGGAGCGTCTACTCGAGTAGACGCTCCAGGTGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_176818.1-238s21c1
Sequence:CCGGTCGGTCCTGGAGGACAGATGTCTCGAGACATCTGTCCTCCAGGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_176818.1-169s21c1
Sequence:CCGGCTGGAGAAAGCTATCGCCTTCCTCGAGGAAGGCGATAGCTTTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176818.1-123s21c1
Sequence:CCGGGCGTCTAGCGCTTGTGGACTTCTCGAGAAGTCCACAAGCGCTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176818
VALIDATED
GATC MISSION shRNA shRNA Plasmid DNA
glutamyl-tRNA(Gln) amidotransferase, subunit C
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000234607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_176818.1-109s21c1
Sequence:CCGGATCGAGCACCTGGAGCGTCTACTCGAGTAGACGCTCCAGGTGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_176818.1-238s21c1
Sequence:CCGGTCGGTCCTGGAGGACAGATGTCTCGAGACATCTGTCCTCCAGGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_176818.1-169s21c1
Sequence:CCGGCTGGAGAAAGCTATCGCCTTCCTCGAGGAAGGCGATAGCTTTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176818.1-123s21c1
Sequence:CCGGGCGTCTAGCGCTTGTGGACTTCTCGAGAAGTCCACAAGCGCTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176818
VALIDATED
GATC MISSION shRNA Lentiviral Transduction Particles
glutamyl-tRNA(Gln) amidotransferase, subunit C
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000234607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_176818.1-109s21c1
Sequence:CCGGATCGAGCACCTGGAGCGTCTACTCGAGTAGACGCTCCAGGTGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_176818.1-238s21c1
Sequence:CCGGTCGGTCCTGGAGGACAGATGTCTCGAGACATCTGTCCTCCAGGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_176818.1-169s21c1
Sequence:CCGGCTGGAGAAAGCTATCGCCTTCCTCGAGGAAGGCGATAGCTTTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176818.1-123s21c1
Sequence:CCGGGCGTCTAGCGCTTGTGGACTTCTCGAGAAGTCCACAAGCGCTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks