EMAIL THIS PAGE TO A FRIEND

GATM

glycine amidinotransferase (L-arginine:glycine amidinotransferase)

148 Gene Product Result for
Synonyms: AGAT AT CCDS3
UniProtKB ID: P50440, B4DH99, B4DPI3, Q53EQ4
Gene ID:
Human(2628) Summary: This gene encodes a mitochondrial enzyme that belongs to the amidinotransferase family. This enzyme is involved in creatine biosynthesis, whereby it catalyzes the transfer of a guanido group from L-arginine to glycine, resulting in guanidinoacetic acid, the immediate precursor of creatine. Mutations in this gene cause arginine:glycine amidinotransferase deficiency, an inborn error of creatine synthesis characterized by mental retardation, language impairment, and behavioral disorders. [provided by RefSeq, Jul 2008]
Mouse(67092) glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Rat(81660) glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Zebrafish(266799) glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Horse(100070511) glycine amidinotransferase (L-arginine:glycine amidinotransferase)
cow(414732) glycine amidinotransferase (L-arginine:glycine amidinotransferase)
domestic cat(414734) glycine amidinotransferase (L-arginine:glycine amidinotransferase)
dog(414733) glycine amidinotransferase (L-arginine:glycine amidinotransferase)
chicken(395504) glycine amidinotransferase (L-arginine:glycine amidinotransferase)
domestic guinea pig(100714491) glycine amidinotransferase (L-arginine:glycine amidinotransferase)
naked mole-rat(101696418) glycine amidinotransferase (L-arginine:glycine amidinotransferase)
sheep(100174904) glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Domestic Rabbit(100338260) glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025961 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025961 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025961 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001482 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001482 Rosetta Predictions human pricing
NM_031031 Rosetta Predictions rat pricing
XM_575224 Rosetta Predictions rat pricing
NM_025961 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032559 predicted 1027
2 SASI_Hs01_00032561 predicted 1018
3 SASI_Hs01_00032562 predicted 975
4 SASI_Hs01_00032564 predicted 1496
5 SASI_Hs01_00032565 predicted 1094
6 SASI_Hs01_00032566 predicted 1146
7 SASI_Hs01_00032567 predicted 1226
8 SASI_Hs01_00032568 predicted 1248
9 SASI_Hs02_00331963 predicted 1064
10 SASI_Hs02_00331964 predicted 983
11 SASI_Hs01_00032560 predicted 828
12 SASI_Hs01_00032563 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264234 predicted 1128
2 SASI_Rn01_00037408 predicted 1219
3 SASI_Rn01_00037410 predicted 922
4 SASI_Rn01_00037411 predicted 1168
5 SASI_Rn01_00037412 predicted 873
6 SASI_Rn01_00037413 predicted 1211
7 SASI_Rn01_00037414 predicted 1401
8 SASI_Rn01_00037415 predicted 523
9 SASI_Rn01_00037416 predicted 908
10 SASI_Rn02_00264235 predicted 948
11 SASI_Rn01_00037409 predicted 1176
12 SASI_Rn01_00037417 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131474 predicted 299
2 SASI_Rn01_00131475 predicted 369
3 SASI_Rn01_00131476 predicted 339
4 SASI_Rn01_00131477 predicted 371
5 SASI_Rn01_00131478 predicted 303
6 SASI_Rn01_00131479 predicted 305
7 SASI_Rn01_00131480 predicted 329
8 SASI_Rn01_00131481 predicted 327
9 SASI_Rn01_00131482 predicted 299
10 SASI_Rn01_00131483 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077265 predicted 1128
2 SASI_Mm01_00077266 predicted 1064
3 SASI_Mm01_00077267 predicted 803
4 SASI_Mm01_00077268 predicted 1224
5 SASI_Mm01_00077269 predicted 1215
6 SASI_Mm02_00329364 predicted 830
7 SASI_Mm02_00329365 predicted 812
8 SASI_Mm02_00329366 predicted 1022
9 SASI_Mm02_00329367 predicted 905
10 SASI_Mm01_00077271 predicted 759
11 SASI_Mm01_00077270 predicted 652
12 SASI_Mm01_00077272 predicted 574
13 SASI_Mm01_00077273 predicted 881
14 SASI_Mm01_00077274 predicted 1417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025961
GATM MISSION shRNA Bacterial Glycerol Stock
glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025961.2-2114s1c1
Sequence:CCGGGCTTAGTGTAATAGAGTGAAACTCGAGTTTCACTCTATTACACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025961.2-1221s1c1
Sequence:CCGGGCTGGGTATCAGTACCATTAACTCGAGTTAATGGTACTGATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025961.2-645s1c1
Sequence:CCGGCCGAGCATACAGGTCAATTATCTCGAGATAATTGACCTGTATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025961.2-1186s1c1
Sequence:CCGGGCCAATGAAGTTCCAATTCAACTCGAGTTGAATTGGAACTTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025961.2-726s1c1
Sequence:CCGGCGAACTGTATGACCAGAATTACTCGAGTAATTCTGGTCATACAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025961
GATM MISSION shRNA shRNA Plasmid DNA
glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025961.2-2114s1c1
Sequence:CCGGGCTTAGTGTAATAGAGTGAAACTCGAGTTTCACTCTATTACACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025961.2-1221s1c1
Sequence:CCGGGCTGGGTATCAGTACCATTAACTCGAGTTAATGGTACTGATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025961.2-645s1c1
Sequence:CCGGCCGAGCATACAGGTCAATTATCTCGAGATAATTGACCTGTATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025961.2-1186s1c1
Sequence:CCGGGCCAATGAAGTTCCAATTCAACTCGAGTTGAATTGGAACTTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025961.2-726s1c1
Sequence:CCGGCGAACTGTATGACCAGAATTACTCGAGTAATTCTGGTCATACAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025961
GATM MISSION shRNA Lentiviral Transduction Particles
glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025961.2-2114s1c1
Sequence:CCGGGCTTAGTGTAATAGAGTGAAACTCGAGTTTCACTCTATTACACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025961.2-1221s1c1
Sequence:CCGGGCTGGGTATCAGTACCATTAACTCGAGTTAATGGTACTGATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025961.2-645s1c1
Sequence:CCGGCCGAGCATACAGGTCAATTATCTCGAGATAATTGACCTGTATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025961.2-1186s1c1
Sequence:CCGGGCCAATGAAGTTCCAATTCAACTCGAGTTGAATTGGAACTTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025961.2-726s1c1
Sequence:CCGGCGAACTGTATGACCAGAATTACTCGAGTAATTCTGGTCATACAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001482
VALIDATED
GATM MISSION shRNA Bacterial Glycerol Stock
glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-648s1c1
Sequence:CCGGCCGAGCGTACAGGTCAATTATCTCGAGATAATTGACCTGTACGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-262s1c1
Sequence:CCGGCCTGTCTCTTCTTACAACGAACTCGAGTTCGTTGTAAGAAGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-1224s1c1
Sequence:CCGGGCTGGGTATCACTACCATTAACTCGAGTTAATGGTAGTGATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-571s1c1
Sequence:CCGGCCTCGAGACATCCTGATAGTTCTCGAGAACTATCAGGATGTCTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-1186s1c1
Sequence:CCGGGATGCCAATGAAGTTCCAATTCTCGAGAATTGGAACTTCATTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001482
VALIDATED
GATM MISSION shRNA shRNA Plasmid DNA
glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-648s1c1
Sequence:CCGGCCGAGCGTACAGGTCAATTATCTCGAGATAATTGACCTGTACGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-262s1c1
Sequence:CCGGCCTGTCTCTTCTTACAACGAACTCGAGTTCGTTGTAAGAAGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-1224s1c1
Sequence:CCGGGCTGGGTATCACTACCATTAACTCGAGTTAATGGTAGTGATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-571s1c1
Sequence:CCGGCCTCGAGACATCCTGATAGTTCTCGAGAACTATCAGGATGTCTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-1186s1c1
Sequence:CCGGGATGCCAATGAAGTTCCAATTCTCGAGAATTGGAACTTCATTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001482
VALIDATED
GATM MISSION shRNA Lentiviral Transduction Particles
glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-648s1c1
Sequence:CCGGCCGAGCGTACAGGTCAATTATCTCGAGATAATTGACCTGTACGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-262s1c1
Sequence:CCGGCCTGTCTCTTCTTACAACGAACTCGAGTTCGTTGTAAGAAGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-1224s1c1
Sequence:CCGGGCTGGGTATCACTACCATTAACTCGAGTTAATGGTAGTGATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-571s1c1
Sequence:CCGGCCTCGAGACATCCTGATAGTTCTCGAGAACTATCAGGATGTCTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001482.1-1186s1c1
Sequence:CCGGGATGCCAATGAAGTTCCAATTCTCGAGAATTGGAACTTCATTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks