EMAIL THIS PAGE TO A FRIEND

GATS

GATS, stromal antigen 3 opposite strand

51 Gene Product Result for
Synonyms: STAG3OS
Species: Human GATS(352954)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178831 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112131 MISSION® esiRNA esiRNA human AC124781.4-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178831 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056389 predicted 810
2 SASI_Hs01_00056390 predicted 93
3 SASI_Hs01_00056391 predicted 864
4 SASI_Hs01_00056392 predicted 308
5 SASI_Hs01_00056393 predicted 478
6 SASI_Hs01_00056394 predicted 795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178831
GATS MISSION shRNA Bacterial Glycerol Stock
GATS, stromal antigen 3 opposite strand
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178831.4-151s1c1
Sequence:CCGGCAGGTGCAAGTTCTTCAGTCTCTCGAGAGACTGAAGAACTTGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178831.4-453s1c1
Sequence:CCGGCGTTGTCATCAGAGTTCACCACTCGAGTGGTGAACTCTGATGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178831.4-3266s1c1
Sequence:CCGGCCAGTCAGAAACTACCGACTACTCGAGTAGTCGGTAGTTTCTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178831.4-145s1c1
Sequence:CCGGCAAGACCAGGTGCAAGTTCTTCTCGAGAAGAACTTGCACCTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178831.4-1330s1c1
Sequence:CCGGGCAGGATCAATGATGGGATAACTCGAGTTATCCCATCATTGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178831.4-367s1c1
Sequence:CCGGCCAGAACATATCCGTGTTCATCTCGAGATGAACACGGATATGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178831.4-454s1c1
Sequence:CCGGGTTGTCATCAGAGTTCACCATCTCGAGATGGTGAACTCTGATGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178831.4-891s1c1
Sequence:CCGGGCCGTTCTTCATTTGACTCATCTCGAGATGAGTCAAATGAAGAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178831.4-121s1c1
Sequence:CCGGGATCAAACTTGCCTTCCTGTTCTCGAGAACAGGAAGGCAAGTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178831
GATS MISSION shRNA shRNA Plasmid DNA
GATS, stromal antigen 3 opposite strand
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178831.4-151s1c1
Sequence:CCGGCAGGTGCAAGTTCTTCAGTCTCTCGAGAGACTGAAGAACTTGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178831.4-453s1c1
Sequence:CCGGCGTTGTCATCAGAGTTCACCACTCGAGTGGTGAACTCTGATGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178831.4-3266s1c1
Sequence:CCGGCCAGTCAGAAACTACCGACTACTCGAGTAGTCGGTAGTTTCTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178831.4-145s1c1
Sequence:CCGGCAAGACCAGGTGCAAGTTCTTCTCGAGAAGAACTTGCACCTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178831.4-1330s1c1
Sequence:CCGGGCAGGATCAATGATGGGATAACTCGAGTTATCCCATCATTGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178831.4-367s1c1
Sequence:CCGGCCAGAACATATCCGTGTTCATCTCGAGATGAACACGGATATGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178831.4-454s1c1
Sequence:CCGGGTTGTCATCAGAGTTCACCATCTCGAGATGGTGAACTCTGATGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178831.4-891s1c1
Sequence:CCGGGCCGTTCTTCATTTGACTCATCTCGAGATGAGTCAAATGAAGAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178831.4-121s1c1
Sequence:CCGGGATCAAACTTGCCTTCCTGTTCTCGAGAACAGGAAGGCAAGTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178831
GATS MISSION shRNA Lentiviral Transduction Particles
GATS, stromal antigen 3 opposite strand
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178831.4-151s1c1
Sequence:CCGGCAGGTGCAAGTTCTTCAGTCTCTCGAGAGACTGAAGAACTTGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178831.4-453s1c1
Sequence:CCGGCGTTGTCATCAGAGTTCACCACTCGAGTGGTGAACTCTGATGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178831.4-3266s1c1
Sequence:CCGGCCAGTCAGAAACTACCGACTACTCGAGTAGTCGGTAGTTTCTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178831.4-145s1c1
Sequence:CCGGCAAGACCAGGTGCAAGTTCTTCTCGAGAAGAACTTGCACCTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178831.4-1330s1c1
Sequence:CCGGGCAGGATCAATGATGGGATAACTCGAGTTATCCCATCATTGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178831.4-367s1c1
Sequence:CCGGCCAGAACATATCCGTGTTCATCTCGAGATGAACACGGATATGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178831.4-454s1c1
Sequence:CCGGGTTGTCATCAGAGTTCACCATCTCGAGATGGTGAACTCTGATGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178831.4-891s1c1
Sequence:CCGGGCCGTTCTTCATTTGACTCATCTCGAGATGAGTCAAATGAAGAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178831.4-121s1c1
Sequence:CCGGGATCAAACTTGCCTTCCTGTTCTCGAGAACAGGAAGGCAAGTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks