EMAIL THIS PAGE TO A FRIEND

GATSL1

GATS protein-like 1

33 Gene Product Result for
Species: Human GATSL1(389523)
UniProtKB ID: A6NNH0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145063 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715901 Rosetta Predictions human pricing
XM_371923 Rosetta Predictions human pricing
XM_935555 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00406879 predicted 737
2 SASI_Hs02_00406880 predicted 1058
3 SASI_Hs02_00406881 predicted 919
4 SASI_Hs02_00406882 predicted 1059
5 SASI_Hs02_00406883 predicted 1047
6 SASI_Hs02_00406884 predicted 1051
7 SASI_Hs02_00406885 predicted 1010
8 SASI_Hs02_00406886 predicted 1178
9 SASI_Hs02_00406887 predicted 1217
10 SASI_Hs02_00406888 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298534 predicted 816
2 SASI_Hs01_00298535 predicted 1140
3 SASI_Hs01_00298536 predicted 998
4 SASI_Hs01_00298537 predicted 1131
5 SASI_Hs01_00298538 predicted 1128
6 SASI_Hs01_00298539 predicted 1134
7 SASI_Hs01_00298540 predicted 1081
8 SASI_Hs01_00298541 predicted 1262
9 SASI_Hs01_00298542 predicted 1292
10 SASI_Hs01_00298543 predicted 83
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00481840 predicted 744
2 SASI_Hs02_00481841 predicted 1058
3 SASI_Hs02_00481842 predicted 918
4 SASI_Hs02_00481843 predicted 1054
5 SASI_Hs02_00481844 predicted 1053
6 SASI_Hs02_00481845 predicted 1050
7 SASI_Hs02_00481846 predicted 1009
8 SASI_Hs02_00481847 predicted 1181
9 SASI_Hs02_00481848 predicted 1219
10 SASI_Hs02_00481849 predicted 1190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145063
GATSL1 MISSION shRNA Bacterial Glycerol Stock
GATS protein-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-40s21c1
Sequence:CCGGAGCGTCGCCAACGAGAGTATACTCGAGTATACTCTCGTTGGCGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-317s21c1
Sequence:CCGGCACTGGCTGACCAGAACATATCTCGAGATATGTTCTGGTCAGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-139s21c1
Sequence:CCGGACGCCAGAGGATTACACTATCCTCGAGGATAGTGTAATCCTCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-68s21c1
Sequence:CCGGTCACCTACGGCCTGATCAAACCTCGAGGTTTGATCAGGCCGTAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-739s21c1
Sequence:CCGGCAGCAGAGGTTTCCTAGTAACCTCGAGGTTACTAGGAAACCTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145063
GATSL1 MISSION shRNA shRNA Plasmid DNA
GATS protein-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-40s21c1
Sequence:CCGGAGCGTCGCCAACGAGAGTATACTCGAGTATACTCTCGTTGGCGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-317s21c1
Sequence:CCGGCACTGGCTGACCAGAACATATCTCGAGATATGTTCTGGTCAGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-139s21c1
Sequence:CCGGACGCCAGAGGATTACACTATCCTCGAGGATAGTGTAATCCTCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-68s21c1
Sequence:CCGGTCACCTACGGCCTGATCAAACCTCGAGGTTTGATCAGGCCGTAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-739s21c1
Sequence:CCGGCAGCAGAGGTTTCCTAGTAACCTCGAGGTTACTAGGAAACCTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145063
GATSL1 MISSION shRNA Lentiviral Transduction Particles
GATS protein-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-40s21c1
Sequence:CCGGAGCGTCGCCAACGAGAGTATACTCGAGTATACTCTCGTTGGCGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-317s21c1
Sequence:CCGGCACTGGCTGACCAGAACATATCTCGAGATATGTTCTGGTCAGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-139s21c1
Sequence:CCGGACGCCAGAGGATTACACTATCCTCGAGGATAGTGTAATCCTCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-68s21c1
Sequence:CCGGTCACCTACGGCCTGATCAAACCTCGAGGTTTGATCAGGCCGTAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145063.1-739s21c1
Sequence:CCGGCAGCAGAGGTTTCCTAGTAACCTCGAGGTTACTAGGAAACCTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks