EMAIL THIS PAGE TO A FRIEND

GATSL2

GATS protein-like 2

62 Gene Product Result for
UniProtKB ID: A6NHX0, B9EJH9
Gene ID:
Mouse(80909) GATS protein-like 2
Rat(304410) GATS protein-like 2
Zebrafish(327294) GATS protein-like 2
cow(524593) GATS protein-like 2
Horse(100063037) GATS protein-like 2
domestic cat(101099347) GATS protein-like 2
chicken(417483) GATS protein-like 2
Goat(100861035) GATS protein-like 2
naked mole-rat(101719893) GATS protein-like 2
domestic guinea pig(100724971) GATS protein-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145064 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU090081 MISSION® esiRNA esiRNA targeting mouse Gats (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717397 Rosetta Predictions human pricing
XM_001721738 Rosetta Predictions human pricing
XM_001077942 Rosetta Predictions rat pricing
XM_222092 Rosetta Predictions rat pricing
NM_030719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00416998 predicted 914
2 SASI_Hs02_00416999 predicted 1242
3 SASI_Hs02_00417000 predicted 1357
4 SASI_Hs02_00417001 predicted 1390
5 SASI_Hs02_00417002 predicted 1099
6 SASI_Hs02_00417003 predicted 1361
7 SASI_Hs02_00417004 predicted 1230
8 SASI_Hs02_00417005 predicted 1226
9 SASI_Hs02_00417006 predicted 167
10 SASI_Hs02_00417007 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00444722 predicted 421
2 SASI_Hs02_00444723 predicted 743
3 SASI_Hs02_00444724 predicted 600
4 SASI_Hs02_00444725 predicted 735
5 SASI_Hs02_00444726 predicted 729
6 SASI_Hs02_00444727 predicted 725
7 SASI_Hs02_00444728 predicted 683
8 SASI_Hs02_00444729 predicted 698
9 SASI_Hs02_00444730 predicted 609
10 SASI_Hs02_00444731 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359081 predicted 739
2 SASI_Rn02_00359082 predicted 1183
3 SASI_Rn02_00359083 predicted 1278
4 SASI_Rn02_00359084 predicted 1186
5 SASI_Rn02_00359085 predicted 839
6 SASI_Rn02_00359086 predicted 921
7 SASI_Rn02_00359087 predicted 587
8 SASI_Rn02_00359088 predicted 777
9 SASI_Rn02_00359089 predicted 709
10 SASI_Rn02_00359090 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00176529 predicted 661
2 SASI_Rn01_00176530 predicted 608
3 SASI_Rn02_00380562 predicted 668
4 SASI_Rn01_00176532 predicted 534
5 SASI_Rn01_00176533 predicted 584
6 SASI_Rn01_00176536 predicted 590
7 SASI_Rn01_00176537 predicted 599
8 SASI_Rn01_00176538 predicted 650
9 SASI_Rn02_00380563 predicted 607
10 SASI_Rn02_00380564 predicted 593
11 SASI_Rn01_00176531 predicted 670
12 SASI_Rn01_00176534 predicted 704
13 SASI_Rn01_00176535 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138299 predicted 1162
2 SASI_Mm01_00138300 predicted 713
3 SASI_Mm01_00138301 predicted 628
4 SASI_Mm01_00138303 predicted 1330
5 SASI_Mm01_00138304 predicted 816
6 SASI_Mm02_00336906 predicted 1761
7 SASI_Mm02_00336907 predicted 1128
8 SASI_Mm01_00138305 predicted 900
9 SASI_Mm01_00138307 predicted 736
10 SASI_Mm01_00138308 predicted 1406
11 SASI_Mm01_00138302 predicted 987
12 SASI_Mm01_00138306 predicted 755
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145064
GATSL2 MISSION shRNA Bacterial Glycerol Stock
GATS protein-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-67s21c1
Sequence:CCGGTTCACCTACGGCCTGATCAAACTCGAGTTTGATCAGGCCGTAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-341s21c1
Sequence:CCGGTGTTCATGCTGTCCACGTATCCTCGAGGATACGTGGACAGCATGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-318s21c1
Sequence:CCGGACTGGCTGACCAGAACATATCCTCGAGGATATGTTCTGGTCAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-788s21c1
Sequence:CCGGTCTGGAAGATGGTCCGGATTGCTCGAGCAATCCGGACCATCTTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-143s21c1
Sequence:CCGGCAGAGGATTACACTATCATTGCTCGAGCAATGATAGTGTAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145064
GATSL2 MISSION shRNA shRNA Plasmid DNA
GATS protein-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-67s21c1
Sequence:CCGGTTCACCTACGGCCTGATCAAACTCGAGTTTGATCAGGCCGTAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-341s21c1
Sequence:CCGGTGTTCATGCTGTCCACGTATCCTCGAGGATACGTGGACAGCATGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-318s21c1
Sequence:CCGGACTGGCTGACCAGAACATATCCTCGAGGATATGTTCTGGTCAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-788s21c1
Sequence:CCGGTCTGGAAGATGGTCCGGATTGCTCGAGCAATCCGGACCATCTTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-143s21c1
Sequence:CCGGCAGAGGATTACACTATCATTGCTCGAGCAATGATAGTGTAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145064
GATSL2 MISSION shRNA Lentiviral Transduction Particles
GATS protein-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-67s21c1
Sequence:CCGGTTCACCTACGGCCTGATCAAACTCGAGTTTGATCAGGCCGTAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-341s21c1
Sequence:CCGGTGTTCATGCTGTCCACGTATCCTCGAGGATACGTGGACAGCATGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-318s21c1
Sequence:CCGGACTGGCTGACCAGAACATATCCTCGAGGATATGTTCTGGTCAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-788s21c1
Sequence:CCGGTCTGGAAGATGGTCCGGATTGCTCGAGCAATCCGGACCATCTTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145064.1-143s21c1
Sequence:CCGGCAGAGGATTACACTATCATTGCTCGAGCAATGATAGTGTAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030719
VALIDATED
GATSL2 MISSION shRNA Bacterial Glycerol Stock
GATS protein-like 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-3201s21c1
Sequence:CCGGTGTATTGTACACACCTATAAACTCGAGTTTATAGGTGTGTACAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-1038s21c1
Sequence:CCGGGTTCCCGAGTCACTTGCTATTCTCGAGAATAGCAAGTGACTCGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-1165s21c1
Sequence:CCGGGCAGACATCCCAGCATATTACCTCGAGGTAATATGCTGGGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-1261s21c1
Sequence:CCGGAGTCAAGCAGGGAAGCATTAGCTCGAGCTAATGCTTCCCTGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-617s21c1
Sequence:CCGGACCAGAACATCTCCGTGTTTACTCGAGTAAACACGGAGATGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030719.2-656s1c1
Sequence:CCGGCGTGTTTATGCTGTCCACCTACTCGAGTAGGTGGACAGCATAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030719.2-930s1c1
Sequence:CCGGGATGTGATGTTCTACTCCAATCTCGAGATTGGAGTAGAACATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030719.2-465s1c1
Sequence:CCGGGACTACACCATCATCGTAGATCTCGAGATCTACGATGATGGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030719
VALIDATED
GATSL2 MISSION shRNA shRNA Plasmid DNA
GATS protein-like 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-3201s21c1
Sequence:CCGGTGTATTGTACACACCTATAAACTCGAGTTTATAGGTGTGTACAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-1038s21c1
Sequence:CCGGGTTCCCGAGTCACTTGCTATTCTCGAGAATAGCAAGTGACTCGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-1165s21c1
Sequence:CCGGGCAGACATCCCAGCATATTACCTCGAGGTAATATGCTGGGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-1261s21c1
Sequence:CCGGAGTCAAGCAGGGAAGCATTAGCTCGAGCTAATGCTTCCCTGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-617s21c1
Sequence:CCGGACCAGAACATCTCCGTGTTTACTCGAGTAAACACGGAGATGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030719.2-656s1c1
Sequence:CCGGCGTGTTTATGCTGTCCACCTACTCGAGTAGGTGGACAGCATAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030719.2-930s1c1
Sequence:CCGGGATGTGATGTTCTACTCCAATCTCGAGATTGGAGTAGAACATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030719.2-465s1c1
Sequence:CCGGGACTACACCATCATCGTAGATCTCGAGATCTACGATGATGGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030719
VALIDATED
GATSL2 MISSION shRNA Lentiviral Transduction Particles
GATS protein-like 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-3201s21c1
Sequence:CCGGTGTATTGTACACACCTATAAACTCGAGTTTATAGGTGTGTACAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-1038s21c1
Sequence:CCGGGTTCCCGAGTCACTTGCTATTCTCGAGAATAGCAAGTGACTCGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-1165s21c1
Sequence:CCGGGCAGACATCCCAGCATATTACCTCGAGGTAATATGCTGGGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-1261s21c1
Sequence:CCGGAGTCAAGCAGGGAAGCATTAGCTCGAGCTAATGCTTCCCTGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030719.3-617s21c1
Sequence:CCGGACCAGAACATCTCCGTGTTTACTCGAGTAAACACGGAGATGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030719.2-656s1c1
Sequence:CCGGCGTGTTTATGCTGTCCACCTACTCGAGTAGGTGGACAGCATAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030719.2-930s1c1
Sequence:CCGGGATGTGATGTTCTACTCCAATCTCGAGATTGGAGTAGAACATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030719.2-465s1c1
Sequence:CCGGGACTACACCATCATCGTAGATCTCGAGATCTACGATGATGGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks