EMAIL THIS PAGE TO A FRIEND

GATSL3

GATS protein-like 3

UniProtKB ID: Q8WTX7, O76052, Q96ND9, Q9UIE8
Gene ID:
Mouse(71962) GATS protein-like 3
Rat(360969) GATS protein-like 3
domestic guinea pig(100724420) GATS protein-like 3
naked mole-rat(101713428) GATS protein-like 3
sheep(101122727) GATS protein-like 3
Zebrafish(449937) GATS protein-like 3
dog(609909) GATS protein-like 3
chicken(770898) GATS protein-like 3
cow(506974) GATS protein-like 3
domestic cat(101090554) GATS protein-like 3
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301599 ANTI-GATL3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB1104074 Anti-GATSL3 (161-175) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028022 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028022 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028022 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001037666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037666 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037666 Rosetta Predictions human pricing
NM_001025128 Rosetta Predictions rat pricing
NM_028022 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107072 predicted 1051
2 SASI_Hs01_00107073 predicted 899
3 SASI_Hs01_00107074 predicted 255
4 SASI_Hs01_00107075 predicted 610
5 SASI_Hs01_00107076 predicted 463
6 SASI_Hs01_00107077 predicted 706
7 SASI_Hs01_00107078 predicted 887
8 SASI_Hs01_00107079 predicted 940
9 SASI_Hs01_00107080 predicted 1044
10 SASI_Hs01_00107081 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203048 predicted 1107
2 SASI_Rn01_00120078 predicted 980
3 SASI_Rn01_00120079 predicted 965
4 SASI_Rn01_00120080 predicted 1154
5 SASI_Rn01_00120081 predicted 374
6 SASI_Rn01_00120082 predicted 712
7 SASI_Rn02_00203049 predicted 1156
8 SASI_Rn01_00120083 predicted 1254
9 SASI_Rn01_00120084 predicted 956
10 SASI_Rn02_00203050 predicted 217
11 SASI_Rn01_00120075 predicted 226
12 SASI_Rn01_00120076 predicted 1109
13 SASI_Rn01_00120077 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134571 predicted 291
2 SASI_Mm01_00134572 predicted 225
3 SASI_Mm01_00134573 predicted 286
4 SASI_Mm01_00134574 predicted 981
5 SASI_Mm01_00134575 predicted 224
6 SASI_Mm02_00333159 predicted 959
7 SASI_Mm01_00134576 predicted 1216
8 SASI_Mm01_00134577 predicted 523
9 SASI_Mm01_00134578 predicted 624
10 SASI_Mm01_00134579 predicted 977
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028022
VALIDATED
GATSL3 MISSION shRNA Bacterial Glycerol Stock
GATS protein-like 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028022.1-211s1c1
Sequence:CCGGGATTACACTCTCATGGTGGATCTCGAGATCCACCATGAGAGTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190980    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028022.1-1316s1c1
Sequence:CCGGCTATGTGACCTCAGCAATGCACTCGAGTGCATTGCTGAGGTCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028022.1-384s1c1
Sequence:CCGGCCATGTGTCTGTTCTGATGTTCTCGAGAACATCAGAACAGACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028022.1-195s21c1
Sequence:CCGGGACTGAGACTCCGGAAGATTACTCGAGTAATCTTCCGGAGTCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028022.1-1156s21c1
Sequence:CCGGTGGTTCTGCTGTCTGTCTGTCCTCGAGGACAGACAGACAGCAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028022.1-226s21c1
Sequence:CCGGGTGGATGAGGAGGGCTTTAAACTCGAGTTTAAAGCCCTCCTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028022.1-996s21c1
Sequence:CCGGGATCGGCTGTGTCATTGATATCTCGAGATATCAATGACACAGCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028022
VALIDATED
GATSL3 MISSION shRNA shRNA Plasmid DNA
GATS protein-like 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028022.1-211s1c1
Sequence:CCGGGATTACACTCTCATGGTGGATCTCGAGATCCACCATGAGAGTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190980    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028022.1-1316s1c1
Sequence:CCGGCTATGTGACCTCAGCAATGCACTCGAGTGCATTGCTGAGGTCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028022.1-384s1c1
Sequence:CCGGCCATGTGTCTGTTCTGATGTTCTCGAGAACATCAGAACAGACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028022.1-195s21c1
Sequence:CCGGGACTGAGACTCCGGAAGATTACTCGAGTAATCTTCCGGAGTCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028022.1-1156s21c1
Sequence:CCGGTGGTTCTGCTGTCTGTCTGTCCTCGAGGACAGACAGACAGCAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028022.1-226s21c1
Sequence:CCGGGTGGATGAGGAGGGCTTTAAACTCGAGTTTAAAGCCCTCCTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028022.1-996s21c1
Sequence:CCGGGATCGGCTGTGTCATTGATATCTCGAGATATCAATGACACAGCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028022
VALIDATED
GATSL3 MISSION shRNA Lentiviral Transduction Particles
GATS protein-like 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028022.1-211s1c1
Sequence:CCGGGATTACACTCTCATGGTGGATCTCGAGATCCACCATGAGAGTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190980    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028022.1-1316s1c1
Sequence:CCGGCTATGTGACCTCAGCAATGCACTCGAGTGCATTGCTGAGGTCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028022.1-384s1c1
Sequence:CCGGCCATGTGTCTGTTCTGATGTTCTCGAGAACATCAGAACAGACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028022.1-195s21c1
Sequence:CCGGGACTGAGACTCCGGAAGATTACTCGAGTAATCTTCCGGAGTCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028022.1-1156s21c1
Sequence:CCGGTGGTTCTGCTGTCTGTCTGTCCTCGAGGACAGACAGACAGCAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028022.1-226s21c1
Sequence:CCGGGTGGATGAGGAGGGCTTTAAACTCGAGTTTAAAGCCCTCCTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028022.1-996s21c1
Sequence:CCGGGATCGGCTGTGTCATTGATATCTCGAGATATCAATGACACAGCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037666
GATSL3 MISSION shRNA Bacterial Glycerol Stock
GATS protein-like 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037666.1-209s1c1
Sequence:CCGGCCATCTGAGTTCCTGCAAGTACTCGAGTACTTGCAGGAACTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037666.2-540s21c1
Sequence:CCGGTGGCCCAGGAGTTCGACATTTCTCGAGAAATGTCGAACTCCTGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037666.2-293s21c1
Sequence:CCGGGTGGACGAGGAGGGCTTTAAACTCGAGTTTAAAGCCCTCCTCGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037666.2-819s21c1
Sequence:CCGGTCTCCCTCATCGAGGGTTATACTCGAGTATAACCCTCGATGAGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037666.2-1167s21c1
Sequence:CCGGGCTTCCAAAGACTTCTCTAAGCTCGAGCTTAGAGAAGTCTTTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037666.2-795s21c1
Sequence:CCGGCCAGCTCCATCACGTTCTTTGCTCGAGCAAAGAACGTGATGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037666
GATSL3 MISSION shRNA shRNA Plasmid DNA
GATS protein-like 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037666.1-209s1c1
Sequence:CCGGCCATCTGAGTTCCTGCAAGTACTCGAGTACTTGCAGGAACTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037666.2-540s21c1
Sequence:CCGGTGGCCCAGGAGTTCGACATTTCTCGAGAAATGTCGAACTCCTGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037666.2-293s21c1
Sequence:CCGGGTGGACGAGGAGGGCTTTAAACTCGAGTTTAAAGCCCTCCTCGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037666.2-819s21c1
Sequence:CCGGTCTCCCTCATCGAGGGTTATACTCGAGTATAACCCTCGATGAGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037666.2-1167s21c1
Sequence:CCGGGCTTCCAAAGACTTCTCTAAGCTCGAGCTTAGAGAAGTCTTTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037666.2-795s21c1
Sequence:CCGGCCAGCTCCATCACGTTCTTTGCTCGAGCAAAGAACGTGATGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037666
GATSL3 MISSION shRNA Lentiviral Transduction Particles
GATS protein-like 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037666.1-209s1c1
Sequence:CCGGCCATCTGAGTTCCTGCAAGTACTCGAGTACTTGCAGGAACTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037666.2-540s21c1
Sequence:CCGGTGGCCCAGGAGTTCGACATTTCTCGAGAAATGTCGAACTCCTGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037666.2-293s21c1
Sequence:CCGGGTGGACGAGGAGGGCTTTAAACTCGAGTTTAAAGCCCTCCTCGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037666.2-819s21c1
Sequence:CCGGTCTCCCTCATCGAGGGTTATACTCGAGTATAACCCTCGATGAGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037666.2-1167s21c1
Sequence:CCGGGCTTCCAAAGACTTCTCTAAGCTCGAGCTTAGAGAAGTCTTTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037666.2-795s21c1
Sequence:CCGGCCAGCTCCATCACGTTCTTTGCTCGAGCAAAGAACGTGATGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks