EMAIL THIS PAGE TO A FRIEND

GBA2

glucosidase, beta (bile acid) 2

95 Gene Product Result for
Synonyms: SPG46
Gene ID:
Human(57704) Summary: This gene encodes a microsomal beta-glucosidase that catalyzes the hydrolysis of bile acid 3-O-glucosides as endogenous compounds. Studies to determine subcellular localization of this protein in the liver indicated that the enzyme was mainly enriched in the microsomal fraction where it appeared to be confined to the endoplasmic reticulum. This putative transmembrane protein is thought to play a role in carbohydrate transport and metabolism. [provided by RefSeq, Jul 2008]
Mouse(230101) glucosidase beta 2
Rat(298399) glucosidase beta 2
Zebrafish(559240) glucosidase, beta (bile acid) 2
domestic cat(101093307) glucosidase, beta (bile acid) 2
Horse(100067772) glucosidase, beta (bile acid) 2
dog(474760) glucosidase, beta (bile acid) 2
chicken(100859407) glucosidase, beta (bile acid) 2
cow(100139170) glucosidase, beta (bile acid) 2
domestic guinea pig(100728889) glucosidase, beta (bile acid) 2
naked mole-rat(101719027) glucosidase, beta (bile acid) 2
sheep(101113987) glucosidase, beta (bile acid) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK129 β-Glucosidase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020944 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172692 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172692 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172692 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020944 Rosetta Predictions human pricing
NM_001013091 Rosetta Predictions rat pricing
NM_172692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156140 predicted 1776
2 SASI_Hs01_00156141 predicted 1606
3 SASI_Hs01_00156144 predicted 1763
4 SASI_Hs01_00156145 predicted 1042
5 SASI_Hs01_00156146 predicted 1115
6 SASI_Hs02_00354348 predicted 2456
7 SASI_Hs01_00156147 predicted 1945
8 SASI_Hs02_00354349 predicted 807
9 SASI_Hs01_00156148 predicted 950
10 SASI_Hs01_00156149 predicted 1855
11 SASI_Hs01_00156142 predicted 2874
12 SASI_Hs01_00156143 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200735 predicted 1198
2 SASI_Rn02_00200736 predicted 228
3 SASI_Rn02_00200737 predicted 256
4 SASI_Rn02_00200738 predicted 1528
5 SASI_Rn02_00200739 predicted 731
6 SASI_Rn02_00200740 predicted 1793
7 SASI_Rn02_00200741 predicted 1520
8 SASI_Rn02_00200742 predicted 1926
9 SASI_Rn02_00200743 predicted 1191
10 SASI_Rn02_00200744 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053232 predicted 1731
2 SASI_Mm01_00053233 predicted 1341
3 SASI_Mm01_00053234 predicted 1727
4 SASI_Mm01_00053235 predicted 1005
5 SASI_Mm01_00053236 predicted 1992
6 SASI_Mm01_00053237 predicted 934
7 SASI_Mm02_00344438 predicted 2512
8 SASI_Mm01_00053239 predicted 2226
9 SASI_Mm01_00053240 predicted 333
10 SASI_Mm01_00053241 predicted 1596
11 SASI_Mm01_00053238 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020944
VALIDATED
GBA2 MISSION shRNA Bacterial Glycerol Stock
glucosidase, beta (bile acid) 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_020944.2-2118s1c1
Sequence:CCGGCGCATGTACAACACATATGATCTCGAGATCATATGTGTTGTACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020944.2-600s1c1
Sequence:CCGGCCACAAGTTTATTGCCCTGAACTCGAGTTCAGGGCAATAAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020944.2-3257s1c1
Sequence:CCGGAGGGCCTATGTTTGGACCAAACTCGAGTTTGGTCCAAACATAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020944.2-2862s1c1
Sequence:CCGGCGTGCTCTCCAAACTATCTTTCTCGAGAAAGATAGTTTGGAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020944.2-1200s1c1
Sequence:CCGGGCTTTCTACCATGCCCTCTATCTCGAGATAGAGGGCATGGTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020944.2-2711s21c1
Sequence:CCGGGCTGTGGAATGGCCGCTATTACTCGAGTAATAGCGGCCATTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020944.2-3318s21c1
Sequence:CCGGACTGTGGGAGGGAAGTGCTAACTCGAGTTAGCACTTCCCTCCCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020944.2-1958s21c1
Sequence:CCGGTGCGCTGTTCAATGAACTATACTCGAGTATAGTTCATTGAACAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020944
VALIDATED
GBA2 MISSION shRNA shRNA Plasmid DNA
glucosidase, beta (bile acid) 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_020944.2-2118s1c1
Sequence:CCGGCGCATGTACAACACATATGATCTCGAGATCATATGTGTTGTACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020944.2-600s1c1
Sequence:CCGGCCACAAGTTTATTGCCCTGAACTCGAGTTCAGGGCAATAAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020944.2-3257s1c1
Sequence:CCGGAGGGCCTATGTTTGGACCAAACTCGAGTTTGGTCCAAACATAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020944.2-2862s1c1
Sequence:CCGGCGTGCTCTCCAAACTATCTTTCTCGAGAAAGATAGTTTGGAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020944.2-1200s1c1
Sequence:CCGGGCTTTCTACCATGCCCTCTATCTCGAGATAGAGGGCATGGTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020944.2-2711s21c1
Sequence:CCGGGCTGTGGAATGGCCGCTATTACTCGAGTAATAGCGGCCATTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020944.2-3318s21c1
Sequence:CCGGACTGTGGGAGGGAAGTGCTAACTCGAGTTAGCACTTCCCTCCCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020944.2-1958s21c1
Sequence:CCGGTGCGCTGTTCAATGAACTATACTCGAGTATAGTTCATTGAACAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020944
VALIDATED
GBA2 MISSION shRNA Lentiviral Transduction Particles
glucosidase, beta (bile acid) 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_020944.2-2118s1c1
Sequence:CCGGCGCATGTACAACACATATGATCTCGAGATCATATGTGTTGTACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020944.2-600s1c1
Sequence:CCGGCCACAAGTTTATTGCCCTGAACTCGAGTTCAGGGCAATAAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020944.2-3257s1c1
Sequence:CCGGAGGGCCTATGTTTGGACCAAACTCGAGTTTGGTCCAAACATAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020944.2-2862s1c1
Sequence:CCGGCGTGCTCTCCAAACTATCTTTCTCGAGAAAGATAGTTTGGAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020944.2-1200s1c1
Sequence:CCGGGCTTTCTACCATGCCCTCTATCTCGAGATAGAGGGCATGGTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020944.2-2711s21c1
Sequence:CCGGGCTGTGGAATGGCCGCTATTACTCGAGTAATAGCGGCCATTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020944.2-3318s21c1
Sequence:CCGGACTGTGGGAGGGAAGTGCTAACTCGAGTTAGCACTTCCCTCCCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020944.2-1958s21c1
Sequence:CCGGTGCGCTGTTCAATGAACTATACTCGAGTATAGTTCATTGAACAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172692
GBA2 MISSION shRNA Bacterial Glycerol Stock
glucosidase, beta (bile acid) 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-243s1c1
Sequence:CCGGGCCGAAAGAGATTCCCAAGTTCTCGAGAACTTGGGAATCTCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-244s1c1
Sequence:CCGGCCGAAAGAGATTCCCAAGTTTCTCGAGAAACTTGGGAATCTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-1413s1c1
Sequence:CCGGGATATGCCTAAGATCATGTTTCTCGAGAAACATGATCTTAGGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-1601s1c1
Sequence:CCGGGTACAAATCTGCACTGTTCAACTCGAGTTGAACAGTGCAGATTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-2487s1c1
Sequence:CCGGGAAGTATTTCCTACCCTGCATCTCGAGATGCAGGGTAGGAAATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172692.1-2372s1c1
Sequence:CCGGCGGACGCTATTACAACTACGACTCGAGTCGTAGTTGTAATAGCGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172692.1-836s1c1
Sequence:CCGGCCTGTGTGGTTACTTTGCTTTCTCGAGAAAGCAAAGTAACCACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172692.1-727s1c1
Sequence:CCGGCAGTCATTGCAGACCAATTTACTCGAGTAAATTGGTCTGCAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172692.2-487s1c1
Sequence:CCGGCAACATCTCTCTCAGTAATTTCTCGAGAAATTACTGAGAGAGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172692
GBA2 MISSION shRNA shRNA Plasmid DNA
glucosidase, beta (bile acid) 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-243s1c1
Sequence:CCGGGCCGAAAGAGATTCCCAAGTTCTCGAGAACTTGGGAATCTCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-244s1c1
Sequence:CCGGCCGAAAGAGATTCCCAAGTTTCTCGAGAAACTTGGGAATCTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-1413s1c1
Sequence:CCGGGATATGCCTAAGATCATGTTTCTCGAGAAACATGATCTTAGGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-1601s1c1
Sequence:CCGGGTACAAATCTGCACTGTTCAACTCGAGTTGAACAGTGCAGATTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-2487s1c1
Sequence:CCGGGAAGTATTTCCTACCCTGCATCTCGAGATGCAGGGTAGGAAATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172692.1-2372s1c1
Sequence:CCGGCGGACGCTATTACAACTACGACTCGAGTCGTAGTTGTAATAGCGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172692.1-836s1c1
Sequence:CCGGCCTGTGTGGTTACTTTGCTTTCTCGAGAAAGCAAAGTAACCACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172692.1-727s1c1
Sequence:CCGGCAGTCATTGCAGACCAATTTACTCGAGTAAATTGGTCTGCAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172692.2-487s1c1
Sequence:CCGGCAACATCTCTCTCAGTAATTTCTCGAGAAATTACTGAGAGAGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172692
GBA2 MISSION shRNA Lentiviral Transduction Particles
glucosidase, beta (bile acid) 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-243s1c1
Sequence:CCGGGCCGAAAGAGATTCCCAAGTTCTCGAGAACTTGGGAATCTCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-244s1c1
Sequence:CCGGCCGAAAGAGATTCCCAAGTTTCTCGAGAAACTTGGGAATCTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-1413s1c1
Sequence:CCGGGATATGCCTAAGATCATGTTTCTCGAGAAACATGATCTTAGGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-1601s1c1
Sequence:CCGGGTACAAATCTGCACTGTTCAACTCGAGTTGAACAGTGCAGATTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172692.1-2487s1c1
Sequence:CCGGGAAGTATTTCCTACCCTGCATCTCGAGATGCAGGGTAGGAAATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172692.1-2372s1c1
Sequence:CCGGCGGACGCTATTACAACTACGACTCGAGTCGTAGTTGTAATAGCGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172692.1-836s1c1
Sequence:CCGGCCTGTGTGGTTACTTTGCTTTCTCGAGAAAGCAAAGTAACCACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172692.1-727s1c1
Sequence:CCGGCAGTCATTGCAGACCAATTTACTCGAGTAAATTGGTCTGCAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172692.2-487s1c1
Sequence:CCGGCAACATCTCTCTCAGTAATTTCTCGAGAAATTACTGAGAGAGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks