EMAIL THIS PAGE TO A FRIEND

GBA3

glucosidase, beta, acid 3

53 Gene Product Result for
Synonyms: CBG CBGL1 GLUC KLRP
Gene ID:
Human(57733) Summary: The protein encoded by this gene is an enzyme that can hydrolyze several types of glycosides. This gene is a polymorphic pseudogene, with the most common allele being the functional allele that encodes the full-length protein. Some individuals, as represented by the reference genome allele, contain a single nucleotide polymorphism that results in a premature stop codon in the coding region, and therefore this allele is pseudogenic due to the failure to produce a functional full-length protein. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Rat(289687) glucosidase, beta, acid 3
sheep(101103396) glucosidase, beta, acid 3 (cytosolic)
naked mole-rat(101704669) glucosidase, beta, acid 3
domestic guinea pig(100379247) glucosidase, beta, acid 3 (cytosolic)
dog(488857) glucosidase, beta, acid 3 (cytosolic)
cow(539625) glucosidase, beta, acid 3 (cytosolic)
domestic cat(101082399) glucosidase, beta, acid 3 (cytosolic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1479 Human GBA3 ELISA for serum, plasma and cell culture supernatants human pricing

Kits

Product # Description Species Add to Cart
 
MAK129 β-Glucosidase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020973 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039431 MISSION® esiRNA esiRNA human GBA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128432 Rosetta Predictions human pricing
NM_020973 Rosetta Predictions human pricing
NM_001106010 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331206 predicted 545
2 SASI_Hs02_00331207 predicted 288
3 SASI_Hs02_00331208 predicted 371
4 SASI_Hs02_00331209 predicted 300
5 SASI_Hs02_00331210 predicted 343
6 SASI_Hs02_00331211 predicted 377
7 SASI_Hs02_00331212 predicted 289
8 SASI_Hs02_00331213 predicted 358
9 SASI_Hs02_00331214 predicted 462
10 SASI_Hs02_00331215 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101255 predicted 245
2 SASI_Hs01_00101256 predicted 257
3 SASI_Hs01_00101257 predicted 607
4 SASI_Hs01_00101258 predicted 525
5 SASI_Hs01_00101260 predicted 1257
6 SASI_Hs01_00101262 predicted 576
7 SASI_Hs02_00354412 predicted 667
8 SASI_Hs02_00354413 predicted 1413
9 SASI_Hs01_00101263 predicted 270
10 SASI_Hs01_00101264 predicted 441
11 SASI_Hs01_00101259 predicted 663
12 SASI_Hs01_00101261 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214742 predicted 774
2 SASI_Rn02_00214743 predicted 456
3 SASI_Rn02_00214744 predicted 867
4 SASI_Rn02_00214745 predicted 412
5 SASI_Rn02_00214746 predicted 249
6 SASI_Rn02_00214747 predicted 589
7 SASI_Rn02_00214748 predicted 415
8 SASI_Rn02_00214749 predicted 393
9 SASI_Rn02_00214750 predicted 303
10 SASI_Rn02_00214751 predicted 471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020973
GBA3 MISSION shRNA Bacterial Glycerol Stock
glucosidase, beta, acid 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020973.3-1643s21c1
Sequence:CCGGTAATGCCTCGTGAAGTATTTACTCGAGTAAATACTTCACGAGGCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020973.3-1013s21c1
Sequence:CCGGTATTATACAACTCGCTTAATCCTCGAGGATTAAGCGAGTTGTATAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020973.3-1067s21c1
Sequence:CCGGATTCTCCAGGATGCGGAAATTCTCGAGAATTTCCGCATCCTGGAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020973.3-1610s21c1
Sequence:CCGGATCAATGGATCTGTGATTAAACTCGAGTTTAATCACAGATCCATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-1215s1c1
Sequence:CCGGGCTGGGAGTATTTCAGACAAACTCGAGTTTGTCTGAAATACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-785s1c1
Sequence:CCGGGCCATCACTTTCCATCTGGATCTCGAGATCCAGATGGAAAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-664s1c1
Sequence:CCGGGCACAGCTATGATTCCTTATTCTCGAGAATAAGGAATCATAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-818s1c1
Sequence:CCGGCCCATATTCATCGATGGTGATCTCGAGATCACCATCGATGAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-313s1c1
Sequence:CCGGGACAGGTTTCATCAACCAGAACTCGAGTTCTGGTTGATGAAACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020973
GBA3 MISSION shRNA shRNA Plasmid DNA
glucosidase, beta, acid 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020973.3-1643s21c1
Sequence:CCGGTAATGCCTCGTGAAGTATTTACTCGAGTAAATACTTCACGAGGCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020973.3-1013s21c1
Sequence:CCGGTATTATACAACTCGCTTAATCCTCGAGGATTAAGCGAGTTGTATAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020973.3-1067s21c1
Sequence:CCGGATTCTCCAGGATGCGGAAATTCTCGAGAATTTCCGCATCCTGGAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020973.3-1610s21c1
Sequence:CCGGATCAATGGATCTGTGATTAAACTCGAGTTTAATCACAGATCCATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-1215s1c1
Sequence:CCGGGCTGGGAGTATTTCAGACAAACTCGAGTTTGTCTGAAATACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-785s1c1
Sequence:CCGGGCCATCACTTTCCATCTGGATCTCGAGATCCAGATGGAAAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-664s1c1
Sequence:CCGGGCACAGCTATGATTCCTTATTCTCGAGAATAAGGAATCATAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-818s1c1
Sequence:CCGGCCCATATTCATCGATGGTGATCTCGAGATCACCATCGATGAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-313s1c1
Sequence:CCGGGACAGGTTTCATCAACCAGAACTCGAGTTCTGGTTGATGAAACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020973
GBA3 MISSION shRNA Lentiviral Transduction Particles
glucosidase, beta, acid 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020973.3-1643s21c1
Sequence:CCGGTAATGCCTCGTGAAGTATTTACTCGAGTAAATACTTCACGAGGCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020973.3-1013s21c1
Sequence:CCGGTATTATACAACTCGCTTAATCCTCGAGGATTAAGCGAGTTGTATAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020973.3-1067s21c1
Sequence:CCGGATTCTCCAGGATGCGGAAATTCTCGAGAATTTCCGCATCCTGGAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020973.3-1610s21c1
Sequence:CCGGATCAATGGATCTGTGATTAAACTCGAGTTTAATCACAGATCCATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-1215s1c1
Sequence:CCGGGCTGGGAGTATTTCAGACAAACTCGAGTTTGTCTGAAATACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-785s1c1
Sequence:CCGGGCCATCACTTTCCATCTGGATCTCGAGATCCAGATGGAAAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-664s1c1
Sequence:CCGGGCACAGCTATGATTCCTTATTCTCGAGAATAAGGAATCATAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-818s1c1
Sequence:CCGGCCCATATTCATCGATGGTGATCTCGAGATCACCATCGATGAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020973.2-313s1c1
Sequence:CCGGGACAGGTTTCATCAACCAGAACTCGAGTTCTGGTTGATGAAACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks