EMAIL THIS PAGE TO A FRIEND

GBA

glucosidase, beta, acid

186 Gene Product Result for
Synonyms: GBA1 GCB GLUC
UniProtKB ID: P04062, A8K796, Q16545, Q4VX22, Q6I9R6, Q9UMJ8
Gene ID:
Human(2629) Summary: This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Mouse(14466) glucosidase, beta, acid
Rat(684536) glucosidase, beta, acid
Zebrafish(559072) glucosidase, beta, acid
domestic cat(101091083) glucosidase, beta, acid
cow(537087) glucosidase, beta, acid
dog(612206) glucosidase, beta, acid
chicken(777161) glucosidase, beta; acid (includes glucosylceramidase)
sheep(101117379) glucosidase, beta, acid
naked mole-rat(101704109) glucosidase, beta, acid
domestic guinea pig(100715257) glucosidase, beta, acid
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK129 β-Glucosidase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000157 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000157 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000157 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109121 MISSION® esiRNA esiRNA human GBA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000157 Rosetta Predictions human pricing
NM_001005741 Rosetta Predictions human pricing
NM_001005742 Rosetta Predictions human pricing
NM_001005749 Rosetta Predictions human pricing
NM_001005750 Rosetta Predictions human pricing
NM_001127639 Rosetta Predictions rat pricing
NM_001077411 Rosetta Predictions mouse pricing
NM_008094 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301973 predicted 1624
2 SASI_Hs01_00071414 predicted 1431
3 SASI_Hs01_00071415 predicted 1639
4 SASI_Hs01_00071416 predicted 1652
5 SASI_Hs01_00071418 predicted 596
6 SASI_Hs01_00071419 predicted 922
7 SASI_Hs01_00071420 predicted 346
8 SASI_Hs01_00071421 predicted 1018
9 SASI_Hs01_00071422 predicted 1033
10 SASI_Hs02_00301974 predicted 572
11 SASI_Hs01_00071413 predicted 608
12 SASI_Hs01_00071417 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305009 predicted 1735
2 SASI_Hs01_00206585 predicted 1549
3 SASI_Hs01_00206586 predicted 1752
4 SASI_Hs01_00206587 predicted 1768
5 SASI_Hs01_00206589 predicted 708
6 SASI_Hs01_00206590 predicted 1027
7 SASI_Hs01_00206591 predicted 462
8 SASI_Hs01_00206592 predicted 1132
9 SASI_Hs01_00206593 predicted 1147
10 SASI_Hs02_00305010 predicted 677
11 SASI_Hs01_00206584 predicted 724
12 SASI_Hs01_00206588 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305011 predicted 1723
2 SASI_Hs01_00150009 predicted 1525
3 SASI_Hs01_00150010 predicted 1726
4 SASI_Hs01_00150011 predicted 1741
5 SASI_Hs01_00150013 predicted 683
6 SASI_Hs01_00150014 predicted 1012
7 SASI_Hs01_00150015 predicted 444
8 SASI_Hs01_00150016 predicted 1111
9 SASI_Hs01_00150017 predicted 1122
10 SASI_Hs02_00305012 predicted 658
11 SASI_Hs01_00150008 predicted 700
12 SASI_Hs01_00150012 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305020 predicted 1876
2 SASI_Hs01_00199815 predicted 1679
3 SASI_Hs01_00199816 predicted 1886
4 SASI_Hs01_00199817 predicted 1901
5 SASI_Hs01_00199819 predicted 849
6 SASI_Hs01_00199820 predicted 1172
7 SASI_Hs01_00199821 predicted 596
8 SASI_Hs01_00199822 predicted 1269
9 SASI_Hs01_00199823 predicted 1288
10 SASI_Hs02_00305021 predicted 824
11 SASI_Hs01_00199814 predicted 864
12 SASI_Hs01_00199818 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305022 predicted 1874
2 SASI_Hs01_00218330 predicted 1684
3 SASI_Hs01_00218331 predicted 1890
4 SASI_Hs01_00218332 predicted 1895
5 SASI_Hs01_00218334 predicted 837
6 SASI_Hs01_00218335 predicted 1169
7 SASI_Hs01_00218336 predicted 594
8 SASI_Hs01_00218337 predicted 1265
9 SASI_Hs01_00218338 predicted 1284
10 SASI_Hs02_00305023 predicted 822
11 SASI_Hs01_00218329 predicted 856
12 SASI_Hs01_00218333 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254720 predicted 1559
2 SASI_Rn02_00254721 predicted 386
3 SASI_Rn02_00254722 predicted 1581
4 SASI_Rn02_00254723 predicted 1008
5 SASI_Rn02_00254724 predicted 1098
6 SASI_Rn02_00254725 predicted 313
7 SASI_Rn02_00254726 predicted 1310
8 SASI_Rn02_00254727 predicted 847
9 SASI_Rn02_00254728 predicted 436
10 SASI_Rn02_00254729 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292642 predicted 858
2 SASI_Mm02_00292643 predicted 534
3 SASI_Mm02_00292644 predicted 1132
4 SASI_Mm02_00292645 predicted 1148
5 SASI_Mm02_00292646 predicted 1339
6 SASI_Mm02_00292647 predicted 563
7 SASI_Mm02_00292648 predicted 892
8 SASI_Mm02_00292649 predicted 462
9 SASI_Mm02_00292650 predicted 700
10 SASI_Mm02_00292651 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313113 predicted 1012
2 SASI_Mm01_00195888 predicted 699
3 SASI_Mm01_00195890 predicted 1283
4 SASI_Mm01_00195892 predicted 1305
5 SASI_Mm01_00195894 predicted 1491
6 SASI_Mm02_00313114 predicted 716
7 SASI_Mm02_00313115 predicted 1049
8 SASI_Mm02_00313116 predicted 623
9 SASI_Mm02_00313117 predicted 863
10 SASI_Mm02_00313118 predicted 707
11 SASI_Mm01_00195887 predicted 716
12 SASI_Mm01_00195889 predicted 1035
13 SASI_Mm01_00195891 predicted 779
14 SASI_Mm01_00195893 predicted 354
15 SASI_Mm01_00195895 predicted 1308
16 SASI_Mm01_00195896 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000157
VALIDATED
GBA MISSION shRNA Bacterial Glycerol Stock
glucosidase, beta, acid
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000157.3-1387s21c1
Sequence:CCGGCACGAACCTCCTGTACCATGTCTCGAGACATGGTACAGGAGGTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000157.3-329s21c1
Sequence:CCGGTGTGTCTGCAATGCCACATACCTCGAGGTATGTGGCATTGCAGACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000157.3-209s21c1
Sequence:CCGGTTGAGTAGGGTAAGCATCATGCTCGAGCATGATGCTTACCCTACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000157.3-1198s21c1
Sequence:CCGGTCATGGCATTGCTGTACATTGCTCGAGCAATGTACAGCAATGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000157.1-1436s1c1
Sequence:CCGGCAGTCCCATCATTGTAGACATCTCGAGATGTCTACAATGATGGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000157.1-581s1c1
Sequence:CCGGCGGATATAACATCATCCGGGTCTCGAGACCCGGATGATGTTATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000157.1-1410s1c1
Sequence:CCGGCCCAATTGGGTGCGTAACTTTCTCGAGAAAGTTACGCACCCAATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000157.1-1143s1c1
Sequence:CCGGGCTAAATATGTTCATGGCATTCTCGAGAATGCCATGAACATATTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000157.1-565s1c1
Sequence:CCGGTCTCTGAAGAAGGAATCGGATCTCGAGATCCGATTCCTTCTTCAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000157
VALIDATED
GBA MISSION shRNA shRNA Plasmid DNA
glucosidase, beta, acid
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000157.3-1387s21c1
Sequence:CCGGCACGAACCTCCTGTACCATGTCTCGAGACATGGTACAGGAGGTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000157.3-329s21c1
Sequence:CCGGTGTGTCTGCAATGCCACATACCTCGAGGTATGTGGCATTGCAGACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000157.3-209s21c1
Sequence:CCGGTTGAGTAGGGTAAGCATCATGCTCGAGCATGATGCTTACCCTACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000157.3-1198s21c1
Sequence:CCGGTCATGGCATTGCTGTACATTGCTCGAGCAATGTACAGCAATGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000157.1-1436s1c1
Sequence:CCGGCAGTCCCATCATTGTAGACATCTCGAGATGTCTACAATGATGGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000157.1-581s1c1
Sequence:CCGGCGGATATAACATCATCCGGGTCTCGAGACCCGGATGATGTTATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000157.1-1410s1c1
Sequence:CCGGCCCAATTGGGTGCGTAACTTTCTCGAGAAAGTTACGCACCCAATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000157.1-1143s1c1
Sequence:CCGGGCTAAATATGTTCATGGCATTCTCGAGAATGCCATGAACATATTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000157.1-565s1c1
Sequence:CCGGTCTCTGAAGAAGGAATCGGATCTCGAGATCCGATTCCTTCTTCAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000157
VALIDATED
GBA MISSION shRNA Lentiviral Transduction Particles
glucosidase, beta, acid
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000157.3-1387s21c1
Sequence:CCGGCACGAACCTCCTGTACCATGTCTCGAGACATGGTACAGGAGGTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000157.3-329s21c1
Sequence:CCGGTGTGTCTGCAATGCCACATACCTCGAGGTATGTGGCATTGCAGACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000157.3-209s21c1
Sequence:CCGGTTGAGTAGGGTAAGCATCATGCTCGAGCATGATGCTTACCCTACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000157.3-1198s21c1
Sequence:CCGGTCATGGCATTGCTGTACATTGCTCGAGCAATGTACAGCAATGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000157.1-1436s1c1
Sequence:CCGGCAGTCCCATCATTGTAGACATCTCGAGATGTCTACAATGATGGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000157.1-581s1c1
Sequence:CCGGCGGATATAACATCATCCGGGTCTCGAGACCCGGATGATGTTATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000157.1-1410s1c1
Sequence:CCGGCCCAATTGGGTGCGTAACTTTCTCGAGAAAGTTACGCACCCAATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000157.1-1143s1c1
Sequence:CCGGGCTAAATATGTTCATGGCATTCTCGAGAATGCCATGAACATATTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000157.1-565s1c1
Sequence:CCGGTCTCTGAAGAAGGAATCGGATCTCGAGATCCGATTCCTTCTTCAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008094
VALIDATED
GBA MISSION shRNA Bacterial Glycerol Stock
glucosidase, beta, acid
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-768s21c1
Sequence:CCGGACTTCTCCATCCGTGTCTATACTCGAGTATAGACACGGATGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-1305s21c1
Sequence:CCGGGCATTGCTGTTCACTGGTATACTCGAGTATACCAGTGAACAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-717s21c1
Sequence:CCGGCTACCAACGGAATTGAATATACTCGAGTATATTCAATTCCGTTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-573s21c1
Sequence:CCGGGCACAGGGTTACTACTCACTTCTCGAGAAGTGAGTAGTAACCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-1003s21c1
Sequence:CCGGTCACCAGACCTGGGCCAATTACTCGAGTAATTGGCCCAGGTCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008094.3-1044s1c1
Sequence:CCGGCTTATGCTAAGTATGGCCTAACTCGAGTTAGGCCATACTTAGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008094.3-573s1c1
Sequence:CCGGGCACAGGGTTACTACTCACTTCTCGAGAAGTGAGTAGTAACCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008094.3-808s1c1
Sequence:CCGGCGACTTCCAGTTATCCAACTTCTCGAGAAGTTGGATAACTGGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008094.3-1305s1c1
Sequence:CCGGGCATTGCTGTTCACTGGTATACTCGAGTATACCAGTGAACAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008094
VALIDATED
GBA MISSION shRNA shRNA Plasmid DNA
glucosidase, beta, acid
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-768s21c1
Sequence:CCGGACTTCTCCATCCGTGTCTATACTCGAGTATAGACACGGATGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-1305s21c1
Sequence:CCGGGCATTGCTGTTCACTGGTATACTCGAGTATACCAGTGAACAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-717s21c1
Sequence:CCGGCTACCAACGGAATTGAATATACTCGAGTATATTCAATTCCGTTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-573s21c1
Sequence:CCGGGCACAGGGTTACTACTCACTTCTCGAGAAGTGAGTAGTAACCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-1003s21c1
Sequence:CCGGTCACCAGACCTGGGCCAATTACTCGAGTAATTGGCCCAGGTCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008094.3-1044s1c1
Sequence:CCGGCTTATGCTAAGTATGGCCTAACTCGAGTTAGGCCATACTTAGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008094.3-573s1c1
Sequence:CCGGGCACAGGGTTACTACTCACTTCTCGAGAAGTGAGTAGTAACCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008094.3-808s1c1
Sequence:CCGGCGACTTCCAGTTATCCAACTTCTCGAGAAGTTGGATAACTGGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008094.3-1305s1c1
Sequence:CCGGGCATTGCTGTTCACTGGTATACTCGAGTATACCAGTGAACAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008094
VALIDATED
GBA MISSION shRNA Lentiviral Transduction Particles
glucosidase, beta, acid
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-768s21c1
Sequence:CCGGACTTCTCCATCCGTGTCTATACTCGAGTATAGACACGGATGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-1305s21c1
Sequence:CCGGGCATTGCTGTTCACTGGTATACTCGAGTATACCAGTGAACAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-717s21c1
Sequence:CCGGCTACCAACGGAATTGAATATACTCGAGTATATTCAATTCCGTTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-573s21c1
Sequence:CCGGGCACAGGGTTACTACTCACTTCTCGAGAAGTGAGTAGTAACCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008094.4-1003s21c1
Sequence:CCGGTCACCAGACCTGGGCCAATTACTCGAGTAATTGGCCCAGGTCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008094.3-1044s1c1
Sequence:CCGGCTTATGCTAAGTATGGCCTAACTCGAGTTAGGCCATACTTAGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008094.3-573s1c1
Sequence:CCGGGCACAGGGTTACTACTCACTTCTCGAGAAGTGAGTAGTAACCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008094.3-808s1c1
Sequence:CCGGCGACTTCCAGTTATCCAACTTCTCGAGAAGTTGGATAACTGGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008094.3-1305s1c1
Sequence:CCGGGCATTGCTGTTCACTGGTATACTCGAGTATACCAGTGAACAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks