EMAIL THIS PAGE TO A FRIEND

GBAS

glioblastoma amplified sequence

Synonyms: NIPSNAP2
UniProtKB ID: O75323, C9IYJ3, O43801, Q53X96
Gene ID:
Human(2631) Summary: This gene encodes a member of the NipSnap family of proteins that may be involved in vesicular transport. The encoded protein is localized to mitochondria and plays a role in oxidative phosphorylation. A pseudogene of this gene is located on the long arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Mouse(14467) glioblastoma amplified sequence
Rat(498174) glioblastoma amplified sequence
Zebrafish(30232) glioblastoma amplified sequence
chicken(417539) glioblastoma amplified sequence
cow(767938) glioblastoma amplified sequence
domestic cat(101086026) glioblastoma amplified sequence
dog(479700) glioblastoma amplified sequence
domestic guinea pig(100729985) glioblastoma amplified sequence
naked mole-rat(101702030) glioblastoma amplified sequence
sheep(101107759) glioblastoma amplified sequence
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100903 Anti-GBAS antibody produced in rabbit affinity isolated antibody canine, horse, bovine, zebrafish, mouse, rat, rabbit, human, guinea pig
western blot pricing
HPA063084 Anti-GBAS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
PRS4943 Anti-NIPSNAP2 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
PRS4953 Anti-NIPSNAP2 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001483 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008095 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008095 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008095 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031851 MISSION® esiRNA esiRNA human GBAS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001483 Rosetta Predictions human pricing
NM_001017486 Rosetta Predictions rat pricing
NM_008095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090727 predicted 494
2 SASI_Hs01_00090728 predicted 831
3 SASI_Hs01_00090729 predicted 297
4 SASI_Hs01_00090730 predicted 551
5 SASI_Hs01_00090731 predicted 609
6 SASI_Hs02_00331965 predicted 256
7 SASI_Hs01_00090732 predicted 211
8 SASI_Hs01_00090733 predicted 225
9 SASI_Hs01_00090734 predicted 902
10 SASI_Hs01_00090735 predicted 205
11 SASI_Hs01_00090726 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017486 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119632 predicted 803
2 SASI_Rn01_00119633 predicted 460
3 SASI_Rn01_00119634 predicted 662
4 SASI_Rn02_00202300 predicted 195
5 SASI_Rn01_00119635 predicted 677
6 SASI_Rn01_00119636 predicted 231
7 SASI_Rn01_00119637 predicted 727
8 SASI_Rn01_00119638 predicted 255
9 SASI_Rn01_00119639 predicted 541
10 SASI_Rn01_00119640 predicted 792
11 SASI_Rn01_00119641 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054055 predicted 876
2 SASI_Mm01_00054054 predicted 680
3 SASI_Mm01_00054056 predicted 345
4 SASI_Mm01_00054057 predicted 927
5 SASI_Mm01_00054058 predicted 857
6 SASI_Mm01_00054060 predicted 262
7 SASI_Mm01_00054061 predicted 324
8 SASI_Mm02_00313119 predicted 679
9 SASI_Mm01_00054063 predicted 947
10 SASI_Mm02_00313120 predicted 1005
11 SASI_Mm01_00054059 predicted 447
12 SASI_Mm01_00054062 predicted 976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001483
VALIDATED
GBAS MISSION shRNA Bacterial Glycerol Stock
glioblastoma amplified sequence
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-294s1c1
Sequence:CCGGGTGTTGCCAAAGATTCACGAACTCGAGTTCGTGAATCTTTGGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-779s1c1
Sequence:CCGGCTGGGAGGAATTGGTATATTACTCGAGTAATATACCAATTCCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-802s1c1
Sequence:CCGGCAGTTCCACTTATTCAGGAAACTCGAGTTTCCTGAATAAGTGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-1818s1c1
Sequence:CCGGCCATGTGAAAGTCCTGTTGAACTCGAGTTCAACAGGACTTTCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001483.1-515s1c1
Sequence:CCGGGTTGGAGTTCAGTTTCTGGAACTCGAGTTCCAGAAACTGAACTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-312s1c1
Sequence:CCGGGAAGATAAACACTACCCTTGTCTCGAGACAAGGGTAGTGTTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001483.1-294s21c1
Sequence:CCGGGTGTTGCCAAAGATTCACGAACTCGAGTTCGTGAATCTTTGGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001483.1-779s21c1
Sequence:CCGGCTGGGAGGAATTGGTATATTACTCGAGTAATATACCAATTCCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001483.1-802s21c1
Sequence:CCGGCAGTTCCACTTATTCAGGAAACTCGAGTTTCCTGAATAAGTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001483.1-1818s21c1
Sequence:CCGGCCATGTGAAAGTCCTGTTGAACTCGAGTTCAACAGGACTTTCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001483
VALIDATED
GBAS MISSION shRNA shRNA Plasmid DNA
glioblastoma amplified sequence
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-294s1c1
Sequence:CCGGGTGTTGCCAAAGATTCACGAACTCGAGTTCGTGAATCTTTGGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-779s1c1
Sequence:CCGGCTGGGAGGAATTGGTATATTACTCGAGTAATATACCAATTCCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-802s1c1
Sequence:CCGGCAGTTCCACTTATTCAGGAAACTCGAGTTTCCTGAATAAGTGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-1818s1c1
Sequence:CCGGCCATGTGAAAGTCCTGTTGAACTCGAGTTCAACAGGACTTTCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001483.1-515s1c1
Sequence:CCGGGTTGGAGTTCAGTTTCTGGAACTCGAGTTCCAGAAACTGAACTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-312s1c1
Sequence:CCGGGAAGATAAACACTACCCTTGTCTCGAGACAAGGGTAGTGTTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001483.1-294s21c1
Sequence:CCGGGTGTTGCCAAAGATTCACGAACTCGAGTTCGTGAATCTTTGGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001483.1-779s21c1
Sequence:CCGGCTGGGAGGAATTGGTATATTACTCGAGTAATATACCAATTCCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001483.1-802s21c1
Sequence:CCGGCAGTTCCACTTATTCAGGAAACTCGAGTTTCCTGAATAAGTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001483.1-1818s21c1
Sequence:CCGGCCATGTGAAAGTCCTGTTGAACTCGAGTTCAACAGGACTTTCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001483
VALIDATED
GBAS MISSION shRNA Lentiviral Transduction Particles
glioblastoma amplified sequence
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-294s1c1
Sequence:CCGGGTGTTGCCAAAGATTCACGAACTCGAGTTCGTGAATCTTTGGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-779s1c1
Sequence:CCGGCTGGGAGGAATTGGTATATTACTCGAGTAATATACCAATTCCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-802s1c1
Sequence:CCGGCAGTTCCACTTATTCAGGAAACTCGAGTTTCCTGAATAAGTGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-1818s1c1
Sequence:CCGGCCATGTGAAAGTCCTGTTGAACTCGAGTTCAACAGGACTTTCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001483.1-515s1c1
Sequence:CCGGGTTGGAGTTCAGTTTCTGGAACTCGAGTTCCAGAAACTGAACTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001483.1-312s1c1
Sequence:CCGGGAAGATAAACACTACCCTTGTCTCGAGACAAGGGTAGTGTTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001483.1-294s21c1
Sequence:CCGGGTGTTGCCAAAGATTCACGAACTCGAGTTCGTGAATCTTTGGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001483.1-779s21c1
Sequence:CCGGCTGGGAGGAATTGGTATATTACTCGAGTAATATACCAATTCCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001483.1-802s21c1
Sequence:CCGGCAGTTCCACTTATTCAGGAAACTCGAGTTTCCTGAATAAGTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001483.1-1818s21c1
Sequence:CCGGCCATGTGAAAGTCCTGTTGAACTCGAGTTCAACAGGACTTTCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008095
VALIDATED
GBAS MISSION shRNA Bacterial Glycerol Stock
glioblastoma amplified sequence
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008095.1-319s1c1
Sequence:CCGGGTGTTACCAAAGATCCACGAACTCGAGTTCGTGGATCTTTGGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008095.1-911s1c1
Sequence:CCGGCGCAGATTACAGTGACGAATACTCGAGTATTCGTCACTGTAATCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008095.1-252s1c1
Sequence:CCGGGTACAAGTTACAGTTTCACAACTCGAGTTGTGAAACTGTAACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008095.4-1686s21c1
Sequence:CCGGCACCTCAACTAGCACTAATTTCTCGAGAAATTAGTGCTAGTTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008095.4-264s21c1
Sequence:CCGGCGAGCAGTCTGTACAAGTTACCTCGAGGTAACTTGTACAGACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008095.4-755s21c1
Sequence:CCGGCACCATCTTTGGGCTTATAAACTCGAGTTTATAAGCCCAAAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008095.4-731s21c1
Sequence:CCGGCAAATTGGGCAGCTCTATATGCTCGAGCATATAGAGCTGCCCAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008095
VALIDATED
GBAS MISSION shRNA shRNA Plasmid DNA
glioblastoma amplified sequence
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008095.1-319s1c1
Sequence:CCGGGTGTTACCAAAGATCCACGAACTCGAGTTCGTGGATCTTTGGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008095.1-911s1c1
Sequence:CCGGCGCAGATTACAGTGACGAATACTCGAGTATTCGTCACTGTAATCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008095.1-252s1c1
Sequence:CCGGGTACAAGTTACAGTTTCACAACTCGAGTTGTGAAACTGTAACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008095.4-1686s21c1
Sequence:CCGGCACCTCAACTAGCACTAATTTCTCGAGAAATTAGTGCTAGTTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008095.4-264s21c1
Sequence:CCGGCGAGCAGTCTGTACAAGTTACCTCGAGGTAACTTGTACAGACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008095.4-755s21c1
Sequence:CCGGCACCATCTTTGGGCTTATAAACTCGAGTTTATAAGCCCAAAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008095.4-731s21c1
Sequence:CCGGCAAATTGGGCAGCTCTATATGCTCGAGCATATAGAGCTGCCCAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008095
VALIDATED
GBAS MISSION shRNA Lentiviral Transduction Particles
glioblastoma amplified sequence
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008095.1-319s1c1
Sequence:CCGGGTGTTACCAAAGATCCACGAACTCGAGTTCGTGGATCTTTGGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008095.1-911s1c1
Sequence:CCGGCGCAGATTACAGTGACGAATACTCGAGTATTCGTCACTGTAATCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008095.1-252s1c1
Sequence:CCGGGTACAAGTTACAGTTTCACAACTCGAGTTGTGAAACTGTAACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008095.4-1686s21c1
Sequence:CCGGCACCTCAACTAGCACTAATTTCTCGAGAAATTAGTGCTAGTTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008095.4-264s21c1
Sequence:CCGGCGAGCAGTCTGTACAAGTTACCTCGAGGTAACTTGTACAGACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008095.4-755s21c1
Sequence:CCGGCACCATCTTTGGGCTTATAAACTCGAGTTTATAAGCCCAAAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008095.4-731s21c1
Sequence:CCGGCAAATTGGGCAGCTCTATATGCTCGAGCATATAGAGCTGCCCAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks