EMAIL THIS PAGE TO A FRIEND

GBE1

glucan (1,4-alpha-), branching enzyme 1

106 Gene Product Result for
Synonyms: APBD GBE GSD4
UniProtKB ID: Q04446, B3KWV3, Q96EN0
Gene ID:
Human(2632) Summary: The protein encoded by this gene is a glycogen branching enzyme that catalyzes the transfer of alpha-1,4-linked glucosyl units from the outer end of a glycogen chain to an alpha-1,6 position on the same or a neighboring glycogen chain. Branching of the chains is essential to increase the solubility of the glycogen molecule and, consequently, in reducing the osmotic pressure within cells. Highest level of this enzyme are found in liver and muscle. Mutations in this gene are associated with glycogen storage disease IV (also known as Andersen's disease). [provided by RefSeq, Jul 2008]
Mouse(74185) glucan (1,4-alpha-), branching enzyme 1
Rat(288333) glucan (1,4-alpha-), branching enzyme 1
chicken(427964) glucan (1,4-alpha-), branching enzyme 1
dog(478380) glucan (1,4-alpha-), branching enzyme 1
Horse(100034152) glucan (1,4-alpha-), branching enzyme 1
cow(615745) glucan (1,4-alpha-), branching enzyme 1
domestic cat(493962) glucan (1,4-alpha-), branching enzyme 1
sheep(101120124) glucan (1,4-alpha-), branching enzyme 1
naked mole-rat(101717308) glucan (1,4-alpha-), branching enzyme 1
domestic guinea pig(100733967) glucan (1,4-alpha-), branching enzyme 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000158 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132131 MISSION® esiRNA esiRNA human GBE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000158 Rosetta Predictions human pricing
XM_001064453 Rosetta Predictions rat pricing
XM_221747 Rosetta Predictions rat pricing
NM_028803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011579 predicted 417
2 SASI_Hs02_00301975 predicted 1644
3 SASI_Hs01_00011581 predicted 1409
4 SASI_Hs01_00011582 predicted 996
5 SASI_Hs01_00011583 predicted 1106
6 SASI_Hs02_00301976 predicted 1820
7 SASI_Hs01_00011584 predicted 2370
8 SASI_Hs01_00011585 predicted 695
9 SASI_Hs01_00011586 predicted 2307
10 SASI_Hs01_00011587 predicted 2244
11 SASI_Hs01_00011578 predicted 2255
12 SASI_Hs01_00011580 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310575 predicted 1240
2 SASI_Rn02_00310576 predicted 897
3 SASI_Rn02_00310577 predicted 1398
4 SASI_Rn02_00310578 predicted 2018
5 SASI_Rn02_00310579 predicted 1516
6 SASI_Rn02_00310580 predicted 1740
7 SASI_Rn02_00310581 predicted 332
8 SASI_Rn02_00310582 predicted 1868
9 SASI_Rn02_00310583 predicted 1362
10 SASI_Rn02_00310584 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380327 predicted 893
2 SASI_Rn02_00380328 predicted 2067
3 SASI_Rn02_00380329 predicted 979
4 SASI_Rn02_00380330 predicted 333
5 SASI_Rn02_00380331 predicted 1902
6 SASI_Rn02_00380332 predicted 324
7 SASI_Rn02_00380333 predicted 2123
8 SASI_Rn02_00380334 predicted 648
9 SASI_Rn02_00380335 predicted 1091
10 SASI_Rn02_00380336 predicted 1914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053726 predicted 1887
2 SASI_Mm01_00053727 predicted 1428
3 SASI_Mm01_00053728 predicted 1144
4 SASI_Mm01_00053729 predicted 514
5 SASI_Mm01_00053730 predicted 843
6 SASI_Mm01_00053731 predicted 778
7 SASI_Mm01_00053732 predicted 201
8 SASI_Mm01_00053734 predicted 1606
9 SASI_Mm01_00053735 predicted 1267
10 SASI_Mm02_00334415 predicted 1522
11 SASI_Mm01_00053733 predicted 1962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028803
VALIDATED
GBE1 MISSION shRNA Bacterial Glycerol Stock
glucan (1,4-alpha-), branching enzyme 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028803.3-1894s21c1
Sequence:CCGGGCCAATAAGACAATCACCTTTCTCGAGAAAGGTGATTGTCTTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028803.3-1187s21c1
Sequence:CCGGCGGGTGACTATAATGAATATTCTCGAGAATATTCATTATAGTCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028803.3-725s21c1
Sequence:CCGGCCAGCAATGTACTACCAAGAACTCGAGTTCTTGGTAGTACATTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028803.2-2295s1c1
Sequence:CCGGGCGTTGGAATACGCAAACATACTCGAGTATGTTTGCGTATTCCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028803.2-1893s1c1
Sequence:CCGGGCCAATAAGACAATCACCTTTCTCGAGAAAGGTGATTGTCTTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028803.2-517s1c1
Sequence:CCGGGCGAGATACTGTATCGCATTTCTCGAGAAATGCGATACAGTATCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028803.2-1186s1c1
Sequence:CCGGCGGGTGACTATAATGAATATTCTCGAGAATATTCATTATAGTCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028803.2-724s1c1
Sequence:CCGGCCAGCAATGTACTACCAAGAACTCGAGTTCTTGGTAGTACATTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028803
VALIDATED
GBE1 MISSION shRNA shRNA Plasmid DNA
glucan (1,4-alpha-), branching enzyme 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028803.3-1894s21c1
Sequence:CCGGGCCAATAAGACAATCACCTTTCTCGAGAAAGGTGATTGTCTTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028803.3-1187s21c1
Sequence:CCGGCGGGTGACTATAATGAATATTCTCGAGAATATTCATTATAGTCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028803.3-725s21c1
Sequence:CCGGCCAGCAATGTACTACCAAGAACTCGAGTTCTTGGTAGTACATTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028803.2-2295s1c1
Sequence:CCGGGCGTTGGAATACGCAAACATACTCGAGTATGTTTGCGTATTCCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028803.2-1893s1c1
Sequence:CCGGGCCAATAAGACAATCACCTTTCTCGAGAAAGGTGATTGTCTTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028803.2-517s1c1
Sequence:CCGGGCGAGATACTGTATCGCATTTCTCGAGAAATGCGATACAGTATCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028803.2-1186s1c1
Sequence:CCGGCGGGTGACTATAATGAATATTCTCGAGAATATTCATTATAGTCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028803.2-724s1c1
Sequence:CCGGCCAGCAATGTACTACCAAGAACTCGAGTTCTTGGTAGTACATTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028803
VALIDATED
GBE1 MISSION shRNA Lentiviral Transduction Particles
glucan (1,4-alpha-), branching enzyme 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028803.3-1894s21c1
Sequence:CCGGGCCAATAAGACAATCACCTTTCTCGAGAAAGGTGATTGTCTTATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028803.3-1187s21c1
Sequence:CCGGCGGGTGACTATAATGAATATTCTCGAGAATATTCATTATAGTCACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028803.3-725s21c1
Sequence:CCGGCCAGCAATGTACTACCAAGAACTCGAGTTCTTGGTAGTACATTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028803.2-2295s1c1
Sequence:CCGGGCGTTGGAATACGCAAACATACTCGAGTATGTTTGCGTATTCCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028803.2-1893s1c1
Sequence:CCGGGCCAATAAGACAATCACCTTTCTCGAGAAAGGTGATTGTCTTATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028803.2-517s1c1
Sequence:CCGGGCGAGATACTGTATCGCATTTCTCGAGAAATGCGATACAGTATCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028803.2-1186s1c1
Sequence:CCGGCGGGTGACTATAATGAATATTCTCGAGAATATTCATTATAGTCACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028803.2-724s1c1
Sequence:CCGGCCAGCAATGTACTACCAAGAACTCGAGTTCTTGGTAGTACATTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000158
VALIDATED
GBE1 MISSION shRNA Bacterial Glycerol Stock
glucan (1,4-alpha-), branching enzyme 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000158.3-1643s21c1
Sequence:CCGGGACTGGAACATGGGCGATATACTCGAGTATATCGCCCATGTTCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000158.3-863s21c1
Sequence:CCGGCCACGGAGTCTAAGAATTTATCTCGAGATAAATTCTTAGACTCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000158.3-2499s21c1
Sequence:CCGGCCAAGCCATCAAGTGTCTGAACTCGAGTTCAGACACTTGATGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000158.3-1826s21c1
Sequence:CCGGCGTGGAATACAGCTTCATAAACTCGAGTTTATGAAGCTGTATTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000158.3-1487s21c1
Sequence:CCGGACGCTGTGTCCCGATTCTATACTCGAGTATAGAATCGGGACACAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000158.1-2294s1c1
Sequence:CCGGCCAAGCCATCAAGTGTCTGAACTCGAGTTCAGACACTTGATGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000158.1-1621s1c1
Sequence:CCGGCGTGGAATACAGCTTCATAAACTCGAGTTTATGAAGCTGTATTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_000158.1-658s1c1
Sequence:CCGGCCACGGAGTCTAAGAATTTATCTCGAGATAAATTCTTAGACTCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000158.1-661s1c1
Sequence:CCGGCGGAGTCTAAGAATTTATGAACTCGAGTTCATAAATTCTTAGACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_000158.1-1804s1c1
Sequence:CCGGCGCTACAAGTTCCTAAATAATCTCGAGATTATTTAGGAACTTGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000158
VALIDATED
GBE1 MISSION shRNA shRNA Plasmid DNA
glucan (1,4-alpha-), branching enzyme 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000158.3-1643s21c1
Sequence:CCGGGACTGGAACATGGGCGATATACTCGAGTATATCGCCCATGTTCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000158.3-863s21c1
Sequence:CCGGCCACGGAGTCTAAGAATTTATCTCGAGATAAATTCTTAGACTCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000158.3-2499s21c1
Sequence:CCGGCCAAGCCATCAAGTGTCTGAACTCGAGTTCAGACACTTGATGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000158.3-1826s21c1
Sequence:CCGGCGTGGAATACAGCTTCATAAACTCGAGTTTATGAAGCTGTATTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000158.3-1487s21c1
Sequence:CCGGACGCTGTGTCCCGATTCTATACTCGAGTATAGAATCGGGACACAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000158.1-2294s1c1
Sequence:CCGGCCAAGCCATCAAGTGTCTGAACTCGAGTTCAGACACTTGATGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000158.1-1621s1c1
Sequence:CCGGCGTGGAATACAGCTTCATAAACTCGAGTTTATGAAGCTGTATTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_000158.1-658s1c1
Sequence:CCGGCCACGGAGTCTAAGAATTTATCTCGAGATAAATTCTTAGACTCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000158.1-661s1c1
Sequence:CCGGCGGAGTCTAAGAATTTATGAACTCGAGTTCATAAATTCTTAGACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_000158.1-1804s1c1
Sequence:CCGGCGCTACAAGTTCCTAAATAATCTCGAGATTATTTAGGAACTTGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000158
VALIDATED
GBE1 MISSION shRNA Lentiviral Transduction Particles
glucan (1,4-alpha-), branching enzyme 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000158.3-1643s21c1
Sequence:CCGGGACTGGAACATGGGCGATATACTCGAGTATATCGCCCATGTTCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000158.3-863s21c1
Sequence:CCGGCCACGGAGTCTAAGAATTTATCTCGAGATAAATTCTTAGACTCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000158.3-2499s21c1
Sequence:CCGGCCAAGCCATCAAGTGTCTGAACTCGAGTTCAGACACTTGATGGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000158.3-1826s21c1
Sequence:CCGGCGTGGAATACAGCTTCATAAACTCGAGTTTATGAAGCTGTATTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000158.3-1487s21c1
Sequence:CCGGACGCTGTGTCCCGATTCTATACTCGAGTATAGAATCGGGACACAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000158.1-2294s1c1
Sequence:CCGGCCAAGCCATCAAGTGTCTGAACTCGAGTTCAGACACTTGATGGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000158.1-1621s1c1
Sequence:CCGGCGTGGAATACAGCTTCATAAACTCGAGTTTATGAAGCTGTATTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_000158.1-658s1c1
Sequence:CCGGCCACGGAGTCTAAGAATTTATCTCGAGATAAATTCTTAGACTCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000158.1-661s1c1
Sequence:CCGGCGGAGTCTAAGAATTTATGAACTCGAGTTCATAAATTCTTAGACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_000158.1-1804s1c1
Sequence:CCGGCGCTACAAGTTCCTAAATAATCTCGAGATTATTTAGGAACTTGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)