EMAIL THIS PAGE TO A FRIEND

GBF1

golgi brefeldin A resistant guanine nucleotide exchange factor 1

61 Gene Product Result for
Synonyms: ARF1GEF
UniProtKB ID: Q92538, Q5VXX3, Q96CK6, Q96HZ3, Q9H473
Gene ID:
Human(8729) Summary: This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(107338) golgi-specific brefeldin A-resistance factor 1
Rat(309451) golgi brefeldin A resistant guanine nucleotide exchange factor 1
Thale Cress(829826) G-box binding factor 1
domestic cat(101101507) golgi brefeldin A resistant guanine nucleotide exchange factor 1
cow(533207) golgi brefeldin A resistant guanine nucleotide exchange factor 1
Horse(100060013) golgi brefeldin A resistant guanine nucleotide exchange factor 1
dog(486857) golgi brefeldin A resistant guanine nucleotide exchange factor 1
chicken(423758) golgi brefeldin A resistant guanine nucleotide exchange factor 1
domestic guinea pig(100716941) golgi brefeldin A resistant guanine nucleotide exchange factor 1
naked mole-rat(101712137) golgi brefeldin A resistant guanine nucleotide exchange factor 1
Goat(100861069) golgi brefeldin A resistant guanine nucleotide exchange factor 1
Domestic Rabbit(100344254) golgi brefeldin A resistant guanine nucleotide exchange factor 1
sheep(101107150) golgi brefeldin A resistant guanine nucleotide exchange factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004193 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004193 Rosetta Predictions human pricing
XM_001066196 Rosetta Predictions rat pricing
XM_219953 Rosetta Predictions rat pricing
NM_178930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125595 predicted 409
2 SASI_Hs01_00125596 predicted 2077
3 SASI_Hs01_00125599 predicted 1508
4 SASI_Hs01_00125600 predicted 3758
5 SASI_Hs02_00337086 predicted 3714
6 SASI_Hs01_00125601 predicted 420
7 SASI_Hs02_00337087 predicted 1601
8 SASI_Hs01_00125602 predicted 5701
9 SASI_Hs02_00337088 predicted 4930
10 SASI_Hs01_00125603 predicted 695
11 SASI_Hs01_00125594 predicted 3380
12 SASI_Hs01_00125597 predicted 5338
13 SASI_Hs01_00125598 predicted 3611
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316603 predicted 2952
2 SASI_Rn02_00316604 predicted 3501
3 SASI_Rn02_00316605 predicted 3184
4 SASI_Rn02_00316606 predicted 3103
5 SASI_Rn02_00316607 predicted 3282
6 SASI_Rn02_00316608 predicted 1157
7 SASI_Rn02_00316609 predicted 4534
8 SASI_Rn02_00316610 predicted 4883
9 SASI_Rn02_00316611 predicted 4089
10 SASI_Rn02_00316612 predicted 1563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378865 predicted 2949
2 SASI_Rn02_00378866 predicted 3505
3 SASI_Rn02_00378867 predicted 3181
4 SASI_Rn02_00378868 predicted 3105
5 SASI_Rn02_00378869 predicted 3282
6 SASI_Rn02_00378870 predicted 1155
7 SASI_Rn02_00378871 predicted 4536
8 SASI_Rn02_00378872 predicted 4875
9 SASI_Rn02_00378873 predicted 4085
10 SASI_Rn02_00378874 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148300 predicted 3048
2 SASI_Mm01_00148301 predicted 1600
3 SASI_Mm01_00148302 predicted 3671
4 SASI_Mm01_00148303 predicted 3279
5 SASI_Mm01_00148305 predicted 3138
6 SASI_Mm01_00148306 predicted 2752
7 SASI_Mm01_00148307 predicted 5342
8 SASI_Mm01_00148308 predicted 1356
9 SASI_Mm01_00148309 predicted 4044
10 SASI_Mm02_00349564 predicted 705
11 SASI_Mm01_00148304 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004193
VALIDATED
GBF1 MISSION shRNA Bacterial Glycerol Stock
golgi brefeldin A resistant guanine nucleotide exchange factor 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004193.1-6160s1c1
Sequence:CCGGCAACCACTCTGCACTTTGTTTCTCGAGAAACAAAGTGCAGAGTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004193.1-4948s1c1
Sequence:CCGGCGAGCACTACTTGTACATGATCTCGAGATCATGTACAAGTAGTGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004193.1-358s1c1
Sequence:CCGGCTGCATAGTTTCGGTCATCTACTCGAGTAGATGACCGAAACTATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-5373s1c1
Sequence:CCGGCCTACGAGATGAACTCTTCAACTCGAGTTGAAGAGTTCATCTCGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004193.1-6171s1c1
Sequence:CCGGCACTTTGTTTCCCACTCCCATCTCGAGATGGGAGTGGGAAACAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-3262s1c1
Sequence:CCGGGCAGCCAAGACAGTATTCCATCTCGAGATGGAATACTGTCTTGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004193.1-1671s1c1
Sequence:CCGGGCGAGTATGCTTCCTACTGTTCTCGAGAACAGTAGGAAGCATACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-4390s1c1
Sequence:CCGGCACGACACTAAGTCTCTGCTTCTCGAGAAGCAGAGACTTAGTGTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-296s1c1
Sequence:CCGGCCATCAAACGAAATGCCCGATCTCGAGATCGGGCATTTCGTTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-6159s1c1
Sequence:CCGGCCAACCACTCTGCACTTTGTTCTCGAGAACAAAGTGCAGAGTGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004193.1-4390s21c1
Sequence:CCGGCACGACACTAAGTCTCTGCTTCTCGAGAAGCAGAGACTTAGTGTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004193.1-4948s21c1
Sequence:CCGGCGAGCACTACTTGTACATGATCTCGAGATCATGTACAAGTAGTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004193.1-5373s21c1
Sequence:CCGGCCTACGAGATGAACTCTTCAACTCGAGTTGAAGAGTTCATCTCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004193.1-6159s21c1
Sequence:CCGGCCAACCACTCTGCACTTTGTTCTCGAGAACAAAGTGCAGAGTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004193.1-358s21c1
Sequence:CCGGCTGCATAGTTTCGGTCATCTACTCGAGTAGATGACCGAAACTATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004193
VALIDATED
GBF1 MISSION shRNA shRNA Plasmid DNA
golgi brefeldin A resistant guanine nucleotide exchange factor 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004193.1-6160s1c1
Sequence:CCGGCAACCACTCTGCACTTTGTTTCTCGAGAAACAAAGTGCAGAGTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004193.1-4948s1c1
Sequence:CCGGCGAGCACTACTTGTACATGATCTCGAGATCATGTACAAGTAGTGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004193.1-358s1c1
Sequence:CCGGCTGCATAGTTTCGGTCATCTACTCGAGTAGATGACCGAAACTATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-5373s1c1
Sequence:CCGGCCTACGAGATGAACTCTTCAACTCGAGTTGAAGAGTTCATCTCGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004193.1-6171s1c1
Sequence:CCGGCACTTTGTTTCCCACTCCCATCTCGAGATGGGAGTGGGAAACAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-3262s1c1
Sequence:CCGGGCAGCCAAGACAGTATTCCATCTCGAGATGGAATACTGTCTTGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004193.1-1671s1c1
Sequence:CCGGGCGAGTATGCTTCCTACTGTTCTCGAGAACAGTAGGAAGCATACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-4390s1c1
Sequence:CCGGCACGACACTAAGTCTCTGCTTCTCGAGAAGCAGAGACTTAGTGTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-296s1c1
Sequence:CCGGCCATCAAACGAAATGCCCGATCTCGAGATCGGGCATTTCGTTTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-6159s1c1
Sequence:CCGGCCAACCACTCTGCACTTTGTTCTCGAGAACAAAGTGCAGAGTGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004193.1-4390s21c1
Sequence:CCGGCACGACACTAAGTCTCTGCTTCTCGAGAAGCAGAGACTTAGTGTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004193.1-4948s21c1
Sequence:CCGGCGAGCACTACTTGTACATGATCTCGAGATCATGTACAAGTAGTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004193.1-5373s21c1
Sequence:CCGGCCTACGAGATGAACTCTTCAACTCGAGTTGAAGAGTTCATCTCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004193.1-6159s21c1
Sequence:CCGGCCAACCACTCTGCACTTTGTTCTCGAGAACAAAGTGCAGAGTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004193.1-358s21c1
Sequence:CCGGCTGCATAGTTTCGGTCATCTACTCGAGTAGATGACCGAAACTATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004193
VALIDATED
GBF1 MISSION shRNA Lentiviral Transduction Particles
golgi brefeldin A resistant guanine nucleotide exchange factor 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004193.1-6160s1c1
Sequence:CCGGCAACCACTCTGCACTTTGTTTCTCGAGAAACAAAGTGCAGAGTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004193.1-4948s1c1
Sequence:CCGGCGAGCACTACTTGTACATGATCTCGAGATCATGTACAAGTAGTGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004193.1-358s1c1
Sequence:CCGGCTGCATAGTTTCGGTCATCTACTCGAGTAGATGACCGAAACTATGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-5373s1c1
Sequence:CCGGCCTACGAGATGAACTCTTCAACTCGAGTTGAAGAGTTCATCTCGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004193.1-6171s1c1
Sequence:CCGGCACTTTGTTTCCCACTCCCATCTCGAGATGGGAGTGGGAAACAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-3262s1c1
Sequence:CCGGGCAGCCAAGACAGTATTCCATCTCGAGATGGAATACTGTCTTGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004193.1-1671s1c1
Sequence:CCGGGCGAGTATGCTTCCTACTGTTCTCGAGAACAGTAGGAAGCATACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-4390s1c1
Sequence:CCGGCACGACACTAAGTCTCTGCTTCTCGAGAAGCAGAGACTTAGTGTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-296s1c1
Sequence:CCGGCCATCAAACGAAATGCCCGATCTCGAGATCGGGCATTTCGTTTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004193.1-6159s1c1
Sequence:CCGGCCAACCACTCTGCACTTTGTTCTCGAGAACAAAGTGCAGAGTGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004193.1-4390s21c1
Sequence:CCGGCACGACACTAAGTCTCTGCTTCTCGAGAAGCAGAGACTTAGTGTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004193.1-4948s21c1
Sequence:CCGGCGAGCACTACTTGTACATGATCTCGAGATCATGTACAAGTAGTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004193.1-5373s21c1
Sequence:CCGGCCTACGAGATGAACTCTTCAACTCGAGTTGAAGAGTTCATCTCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004193.1-6159s21c1
Sequence:CCGGCCAACCACTCTGCACTTTGTTCTCGAGAACAAAGTGCAGAGTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004193.1-358s21c1
Sequence:CCGGCTGCATAGTTTCGGTCATCTACTCGAGTAGATGACCGAAACTATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178930
VALIDATED
GBF1 MISSION shRNA Bacterial Glycerol Stock
golgi brefeldin A resistant guanine nucleotide exchange factor 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178930.3-6231s1c1
Sequence:CCGGCGCCTCCAATTCTTCTTCCTTCTCGAGAAGGAAGAAGAATTGGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178930.3-2313s1c1
Sequence:CCGGCCACGGGAACTAATTGAAATTCTCGAGAATTTCAATTAGTTCCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178930.3-531s1c1
Sequence:CCGGGCACTCATAGATCCAACTCATCTCGAGATGAGTTGGATCTATGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178930.3-365s1c1
Sequence:CCGGGCACAGTTTCAGTAACCTGAACTCGAGTTCAGGTTACTGAAACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178930.3-4403s1c1
Sequence:CCGGCGACACTAAGTCCCTGCTTAACTCGAGTTAAGCAGGGACTTAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178930.3-6187s21c1
Sequence:CCGGTGCACTTTGTTCCTCTCTATCCTCGAGGATAGAGAGGAACAAAGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178930.3-365s21c1
Sequence:CCGGGCACAGTTTCAGTAACCTGAACTCGAGTTCAGGTTACTGAAACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178930.3-5281s21c1
Sequence:CCGGTGATGGACACAGCGGAGATTTCTCGAGAAATCTCCGCTGTGTCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178930.3-1867s21c1
Sequence:CCGGACTATGATTGTGACTACTATTCTCGAGAATAGTAGTCACAATCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178930.3-2313s21c1
Sequence:CCGGCCACGGGAACTAATTGAAATTCTCGAGAATTTCAATTAGTTCCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178930.3-1609s21c1
Sequence:CCGGATGAGATGTGCCGACACTTATCTCGAGATAAGTGTCGGCACATCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178930
VALIDATED
GBF1 MISSION shRNA shRNA Plasmid DNA
golgi brefeldin A resistant guanine nucleotide exchange factor 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178930.3-6231s1c1
Sequence:CCGGCGCCTCCAATTCTTCTTCCTTCTCGAGAAGGAAGAAGAATTGGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178930.3-2313s1c1
Sequence:CCGGCCACGGGAACTAATTGAAATTCTCGAGAATTTCAATTAGTTCCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178930.3-531s1c1
Sequence:CCGGGCACTCATAGATCCAACTCATCTCGAGATGAGTTGGATCTATGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178930.3-365s1c1
Sequence:CCGGGCACAGTTTCAGTAACCTGAACTCGAGTTCAGGTTACTGAAACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178930.3-4403s1c1
Sequence:CCGGCGACACTAAGTCCCTGCTTAACTCGAGTTAAGCAGGGACTTAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178930.3-6187s21c1
Sequence:CCGGTGCACTTTGTTCCTCTCTATCCTCGAGGATAGAGAGGAACAAAGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178930.3-365s21c1
Sequence:CCGGGCACAGTTTCAGTAACCTGAACTCGAGTTCAGGTTACTGAAACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178930.3-5281s21c1
Sequence:CCGGTGATGGACACAGCGGAGATTTCTCGAGAAATCTCCGCTGTGTCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178930.3-1867s21c1
Sequence:CCGGACTATGATTGTGACTACTATTCTCGAGAATAGTAGTCACAATCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178930.3-2313s21c1
Sequence:CCGGCCACGGGAACTAATTGAAATTCTCGAGAATTTCAATTAGTTCCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178930.3-1609s21c1
Sequence:CCGGATGAGATGTGCCGACACTTATCTCGAGATAAGTGTCGGCACATCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178930
VALIDATED
GBF1 MISSION shRNA Lentiviral Transduction Particles
golgi brefeldin A resistant guanine nucleotide exchange factor 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178930.3-6231s1c1
Sequence:CCGGCGCCTCCAATTCTTCTTCCTTCTCGAGAAGGAAGAAGAATTGGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178930.3-2313s1c1
Sequence:CCGGCCACGGGAACTAATTGAAATTCTCGAGAATTTCAATTAGTTCCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178930.3-531s1c1
Sequence:CCGGGCACTCATAGATCCAACTCATCTCGAGATGAGTTGGATCTATGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178930.3-365s1c1
Sequence:CCGGGCACAGTTTCAGTAACCTGAACTCGAGTTCAGGTTACTGAAACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178930.3-4403s1c1
Sequence:CCGGCGACACTAAGTCCCTGCTTAACTCGAGTTAAGCAGGGACTTAGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178930.3-6187s21c1
Sequence:CCGGTGCACTTTGTTCCTCTCTATCCTCGAGGATAGAGAGGAACAAAGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178930.3-365s21c1
Sequence:CCGGGCACAGTTTCAGTAACCTGAACTCGAGTTCAGGTTACTGAAACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178930.3-5281s21c1
Sequence:CCGGTGATGGACACAGCGGAGATTTCTCGAGAAATCTCCGCTGTGTCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178930.3-1867s21c1
Sequence:CCGGACTATGATTGTGACTACTATTCTCGAGAATAGTAGTCACAATCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178930.3-2313s21c1
Sequence:CCGGCCACGGGAACTAATTGAAATTCTCGAGAATTTCAATTAGTTCCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178930.3-1609s21c1
Sequence:CCGGATGAGATGTGCCGACACTTATCTCGAGATAAGTGTCGGCACATCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)