EMAIL THIS PAGE TO A FRIEND

GBGT1

globoside alpha-1,3-N-acetylgalactosaminyltransferase 1

31 Gene Product Result for
Synonyms: A3GALNT FS UNQ2513
Gene ID:
Human(26301) Summary: This gene encodes a member of the histo-blood group ABO gene family that encodes glycosyltransferases with related but distinct substrate specificity. This protein plays a role in synthesizing Forssman glycolipid (FG), a member of the globoseries glycolipid family. Human cells do not normally produce FG but produce the precursor glycolipids globotriaosylceramide and globoside. This protein may be involved in the tropism and binding of pathogenic organisms. [provided by RefSeq, Jul 2008]
Mouse(227671) globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
chicken(417163) globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
cow(618517) globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
domestic cat(101090810) globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
dog(403833) globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
sheep(101112039) globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
naked mole-rat(101726516) globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
domestic guinea pig(100736120) globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051298 Anti-GBGT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021996 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050171 MISSION® esiRNA esiRNA human GBGT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021996 Rosetta Predictions human pricing
NM_139197 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246184 predicted 953
2 SASI_Hs01_00246185 predicted 1485
3 SASI_Hs01_00246186 predicted 687
4 SASI_Hs01_00246187 predicted 1003
5 SASI_Hs01_00246188 predicted 1682
6 SASI_Hs01_00246189 predicted 402
7 SASI_Hs01_00246190 predicted 1171
8 SASI_Hs01_00246191 predicted 937
9 SASI_Hs01_00246192 predicted 1417
10 SASI_Hs01_00246193 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065098 predicted 602
2 SASI_Mm01_00065099 predicted 420
3 SASI_Mm01_00065100 predicted 382
4 SASI_Mm01_00065101 predicted 717
5 SASI_Mm02_00339918 predicted 410
6 SASI_Mm01_00065102 predicted 704
7 SASI_Mm01_00065104 predicted 613
8 SASI_Mm01_00065105 predicted 325
9 SASI_Mm01_00065106 predicted 415
10 SASI_Mm01_00065107 predicted 676
11 SASI_Mm01_00065103 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139197
GBGT1 MISSION shRNA Bacterial Glycerol Stock
globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139197.2-946s21c1
Sequence:CCGGTGCCATTCACCCAGGCTATTTCTCGAGAAATAGCCTGGGTGAATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139197.2-367s21c1
Sequence:CCGGGGTCTCCTACATACCCTATTACTCGAGTAATAGGGTATGTAGGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139197.2-1219s21c1
Sequence:CCGGAGAGTACCTCTGGGATGAAAGCTCGAGCTTTCATCCCAGAGGTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-581s1c1
Sequence:CCGGGAGCCCACAAAGAAGTGGATTCTCGAGAATCCACTTCTTTGTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-706s1c1
Sequence:CCGGCGCCGGAAATTCCCTTATGAACTCGAGTTCATAAGGGAATTTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-420s1c1
Sequence:CCGGCCAAGTACACTATTACCTCTTCTCGAGAAGAGGTAATAGTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-126s1c1
Sequence:CCGGCCCAGAGTTCTTCAACATGAACTCGAGTTCATGTTGAAGAACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-60s1c1
Sequence:CCGGCTGGGTCCTGTGGAAGTTTATCTCGAGATAAACTTCCACAGGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139197
GBGT1 MISSION shRNA shRNA Plasmid DNA
globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139197.2-946s21c1
Sequence:CCGGTGCCATTCACCCAGGCTATTTCTCGAGAAATAGCCTGGGTGAATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139197.2-367s21c1
Sequence:CCGGGGTCTCCTACATACCCTATTACTCGAGTAATAGGGTATGTAGGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139197.2-1219s21c1
Sequence:CCGGAGAGTACCTCTGGGATGAAAGCTCGAGCTTTCATCCCAGAGGTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-581s1c1
Sequence:CCGGGAGCCCACAAAGAAGTGGATTCTCGAGAATCCACTTCTTTGTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-706s1c1
Sequence:CCGGCGCCGGAAATTCCCTTATGAACTCGAGTTCATAAGGGAATTTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-420s1c1
Sequence:CCGGCCAAGTACACTATTACCTCTTCTCGAGAAGAGGTAATAGTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-126s1c1
Sequence:CCGGCCCAGAGTTCTTCAACATGAACTCGAGTTCATGTTGAAGAACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-60s1c1
Sequence:CCGGCTGGGTCCTGTGGAAGTTTATCTCGAGATAAACTTCCACAGGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139197
GBGT1 MISSION shRNA Lentiviral Transduction Particles
globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139197.2-946s21c1
Sequence:CCGGTGCCATTCACCCAGGCTATTTCTCGAGAAATAGCCTGGGTGAATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139197.2-367s21c1
Sequence:CCGGGGTCTCCTACATACCCTATTACTCGAGTAATAGGGTATGTAGGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139197.2-1219s21c1
Sequence:CCGGAGAGTACCTCTGGGATGAAAGCTCGAGCTTTCATCCCAGAGGTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-581s1c1
Sequence:CCGGGAGCCCACAAAGAAGTGGATTCTCGAGAATCCACTTCTTTGTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-706s1c1
Sequence:CCGGCGCCGGAAATTCCCTTATGAACTCGAGTTCATAAGGGAATTTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-420s1c1
Sequence:CCGGCCAAGTACACTATTACCTCTTCTCGAGAAGAGGTAATAGTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-126s1c1
Sequence:CCGGCCCAGAGTTCTTCAACATGAACTCGAGTTCATGTTGAAGAACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139197.1-60s1c1
Sequence:CCGGCTGGGTCCTGTGGAAGTTTATCTCGAGATAAACTTCCACAGGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021996
GBGT1 MISSION shRNA Bacterial Glycerol Stock
globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021996.4-1681s21c1
Sequence:CCGGATTGCCCTTAACGTAGCATTTCTCGAGAAATGCTACGTTAAGGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021996.4-698s21c1
Sequence:CCGGGTACCGGGTGCACTACTACATCTCGAGATGTAGTAGTGCACCCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021996.4-1774s21c1
Sequence:CCGGCCCAACCACATGTAGCCAATTCTCGAGAATTGGCTACATGTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-458s1c1
Sequence:CCGGGCCCGTGGTATGGTCACAGTACTCGAGTACTGTGACCATACCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-1187s1c1
Sequence:CCGGCCGTCACTTCATCTCAAACAACTCGAGTTGTTTGAGATGAAGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-347s1c1
Sequence:CCGGCCTGTGGGTGTATCTTGAGAACTCGAGTTCTCAAGATACACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-1089s1c1
Sequence:CCGGGCCAGGGTATATGAGTTTACTCTCGAGAGTAAACTCATATACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-887s1c1
Sequence:CCGGCTTCTGCCTTGATGTGGACATCTCGAGATGTCCACATCAAGGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021996
GBGT1 MISSION shRNA shRNA Plasmid DNA
globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021996.4-1681s21c1
Sequence:CCGGATTGCCCTTAACGTAGCATTTCTCGAGAAATGCTACGTTAAGGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021996.4-698s21c1
Sequence:CCGGGTACCGGGTGCACTACTACATCTCGAGATGTAGTAGTGCACCCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021996.4-1774s21c1
Sequence:CCGGCCCAACCACATGTAGCCAATTCTCGAGAATTGGCTACATGTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-458s1c1
Sequence:CCGGGCCCGTGGTATGGTCACAGTACTCGAGTACTGTGACCATACCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-1187s1c1
Sequence:CCGGCCGTCACTTCATCTCAAACAACTCGAGTTGTTTGAGATGAAGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-347s1c1
Sequence:CCGGCCTGTGGGTGTATCTTGAGAACTCGAGTTCTCAAGATACACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-1089s1c1
Sequence:CCGGGCCAGGGTATATGAGTTTACTCTCGAGAGTAAACTCATATACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-887s1c1
Sequence:CCGGCTTCTGCCTTGATGTGGACATCTCGAGATGTCCACATCAAGGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021996
GBGT1 MISSION shRNA Lentiviral Transduction Particles
globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021996.4-1681s21c1
Sequence:CCGGATTGCCCTTAACGTAGCATTTCTCGAGAAATGCTACGTTAAGGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021996.4-698s21c1
Sequence:CCGGGTACCGGGTGCACTACTACATCTCGAGATGTAGTAGTGCACCCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021996.4-1774s21c1
Sequence:CCGGCCCAACCACATGTAGCCAATTCTCGAGAATTGGCTACATGTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-458s1c1
Sequence:CCGGGCCCGTGGTATGGTCACAGTACTCGAGTACTGTGACCATACCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-1187s1c1
Sequence:CCGGCCGTCACTTCATCTCAAACAACTCGAGTTGTTTGAGATGAAGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-347s1c1
Sequence:CCGGCCTGTGGGTGTATCTTGAGAACTCGAGTTCTCAAGATACACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-1089s1c1
Sequence:CCGGGCCAGGGTATATGAGTTTACTCTCGAGAGTAAACTCATATACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021996.3-887s1c1
Sequence:CCGGCTTCTGCCTTGATGTGGACATCTCGAGATGTCCACATCAAGGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks