EMAIL THIS PAGE TO A FRIEND

GBP1

guanylate binding protein 1, interferon-inducible

94 Gene Product Result for
UniProtKB ID: P32455, D3DT26, Q5T8M1
Gene ID:
Human(2633) Summary: Guanylate binding protein expression is induced by interferon. Guanylate binding proteins are characterized by their ability to specifically bind guanine nucleotides (GMP, GDP, and GTP) and are distinguished from the GTP-binding proteins by the presence of 2 binding motifs rather than 3. [provided by RefSeq, Jul 2008]
Rat(304266) guanylate binding protein 1, interferon-inducible
Zebrafish(436615) guanylate binding protein 1
cow(281185) guanylate binding protein 1, interferon-inducible, 67kD
domestic cat(101082424) guanylate binding protein 1, interferon-inducible
dog(490172) guanylate binding protein 1, interferon-inducible
naked mole-rat(101699770) guanylate binding protein 1, interferon-inducible
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002053 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002053 Rosetta Predictions human pricing
XM_001078913 Rosetta Predictions rat pricing
XM_221882 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045489 predicted 1365
2 SASI_Hs01_00045490 predicted 1329
3 SASI_Hs01_00045492 predicted 702
4 SASI_Hs01_00045493 predicted 1602
5 SASI_Hs02_00333094 predicted 300
6 SASI_Hs01_00045495 predicted 1416
7 SASI_Hs01_00045496 predicted 887
8 SASI_Hs02_00333095 predicted 274
9 SASI_Hs01_00045498 predicted 1001
10 SASI_Hs02_00333096 predicted 238
11 SASI_Hs01_00045491 predicted 743
12 SASI_Hs01_00045494 predicted 881
13 SASI_Hs01_00045497 predicted 1599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362490 predicted 1139
2 SASI_Rn02_00362491 predicted 1130
3 SASI_Rn02_00362492 predicted 1998
4 SASI_Rn02_00362493 predicted 2029
5 SASI_Rn02_00362494 predicted 1119
6 SASI_Rn02_00362495 predicted 2108
7 SASI_Rn02_00362496 predicted 1983
8 SASI_Rn02_00362497 predicted 1294
9 SASI_Rn02_00362498 predicted 1977
10 SASI_Rn02_00362499 predicted 2097
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380378 predicted 1139
2 SASI_Rn02_00380379 predicted 1128
3 SASI_Rn02_00380380 predicted 2002
4 SASI_Rn02_00380381 predicted 2029
5 SASI_Rn02_00380382 predicted 1123
6 SASI_Rn02_00380383 predicted 2107
7 SASI_Rn02_00380384 predicted 1985
8 SASI_Rn02_00380385 predicted 1286
9 SASI_Rn02_00380386 predicted 1972
10 SASI_Rn02_00380387 predicted 2095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002053
VALIDATED
GBP1 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein 1, interferon-inducible
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002053.1-2052s1c1
Sequence:CCGGCCTCTGTATCAACTCAGGAAACTCGAGTTTCCTGAGTTGATACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002053.1-113s1c1
Sequence:CCGGGAACACTAATGGGCGACTGATCTCGAGATCAGTCGCCCATTAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002053.1-1816s1c1
Sequence:CCGGTGAGACGACGAAAGGCATGTACTCGAGTACATGCCTTTCGTCGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002053.1-1821s1c1
Sequence:CCGGCGACGAAAGGCATGTACCATACTCGAGTATGGTACATGCCTTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002053.1-747s1c1
Sequence:CCGGCGGAAATTCTTCCCAAAGAAACTCGAGTTTCTTTGGGAAGAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002053.2-1628s21c1
Sequence:CCGGTCTATGACTGATGCAATTCTCCTCGAGGAGAATTGCATCAGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002053.2-899s21c1
Sequence:CCGGCGGAAATTCTTCCCAAAGAAACTCGAGTTTCTTTGGGAAGAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002053.2-2237s21c1
Sequence:CCGGTACCACTCAGGAGAAGTTTATCTCGAGATAAACTTCTCCTGAGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002053.2-1973s21c1
Sequence:CCGGCGACGAAAGGCATGTACCATACTCGAGTATGGTACATGCCTTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002053.2-812s21c1
Sequence:CCGGCCAGATGAGTACCTGACATACCTCGAGGTATGTCAGGTACTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002053
VALIDATED
GBP1 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein 1, interferon-inducible
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002053.1-2052s1c1
Sequence:CCGGCCTCTGTATCAACTCAGGAAACTCGAGTTTCCTGAGTTGATACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002053.1-113s1c1
Sequence:CCGGGAACACTAATGGGCGACTGATCTCGAGATCAGTCGCCCATTAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002053.1-1816s1c1
Sequence:CCGGTGAGACGACGAAAGGCATGTACTCGAGTACATGCCTTTCGTCGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002053.1-1821s1c1
Sequence:CCGGCGACGAAAGGCATGTACCATACTCGAGTATGGTACATGCCTTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002053.1-747s1c1
Sequence:CCGGCGGAAATTCTTCCCAAAGAAACTCGAGTTTCTTTGGGAAGAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002053.2-1628s21c1
Sequence:CCGGTCTATGACTGATGCAATTCTCCTCGAGGAGAATTGCATCAGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002053.2-899s21c1
Sequence:CCGGCGGAAATTCTTCCCAAAGAAACTCGAGTTTCTTTGGGAAGAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002053.2-2237s21c1
Sequence:CCGGTACCACTCAGGAGAAGTTTATCTCGAGATAAACTTCTCCTGAGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002053.2-1973s21c1
Sequence:CCGGCGACGAAAGGCATGTACCATACTCGAGTATGGTACATGCCTTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002053.2-812s21c1
Sequence:CCGGCCAGATGAGTACCTGACATACCTCGAGGTATGTCAGGTACTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002053
VALIDATED
GBP1 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein 1, interferon-inducible
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002053.1-2052s1c1
Sequence:CCGGCCTCTGTATCAACTCAGGAAACTCGAGTTTCCTGAGTTGATACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002053.1-113s1c1
Sequence:CCGGGAACACTAATGGGCGACTGATCTCGAGATCAGTCGCCCATTAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002053.1-1816s1c1
Sequence:CCGGTGAGACGACGAAAGGCATGTACTCGAGTACATGCCTTTCGTCGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002053.1-1821s1c1
Sequence:CCGGCGACGAAAGGCATGTACCATACTCGAGTATGGTACATGCCTTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002053.1-747s1c1
Sequence:CCGGCGGAAATTCTTCCCAAAGAAACTCGAGTTTCTTTGGGAAGAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002053.2-1628s21c1
Sequence:CCGGTCTATGACTGATGCAATTCTCCTCGAGGAGAATTGCATCAGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002053.2-899s21c1
Sequence:CCGGCGGAAATTCTTCCCAAAGAAACTCGAGTTTCTTTGGGAAGAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002053.2-2237s21c1
Sequence:CCGGTACCACTCAGGAGAAGTTTATCTCGAGATAAACTTCTCCTGAGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002053.2-1973s21c1
Sequence:CCGGCGACGAAAGGCATGTACCATACTCGAGTATGGTACATGCCTTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002053.2-812s21c1
Sequence:CCGGCCAGATGAGTACCTGACATACCTCGAGGTATGTCAGGTACTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks