EMAIL THIS PAGE TO A FRIEND

GBP2

guanylate binding protein 2, interferon-inducible

55 Gene Product Result for
UniProtKB ID: P32456, Q6GPH0, Q6IAU2, Q86TB0
Gene ID:
Human(2634) Summary: This gene belongs to the guanine-binding protein (GBP) family, which includes interferon-induced proteins that can bind to guanine nucleotides (GMP, GDP and GTP). The encoded protein is a GTPase which hydrolyzes GTP, predominantly to GDP. The protein may play a role as a marker of squamous cell carcinomas. [provided by RefSeq, Jul 2013]
Mouse(14469) guanylate binding protein 2
Rat(171164) guanylate binding protein 2, interferon-inducible
Zebrafish(570622) guanylate binding protein 2
Horse(100052023) guanylate binding protein 2, interferon-inducible
cow(514143) guanylate binding protein 2, interferon-inducible
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004120 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU092401 MISSION® esiRNA esiRNA targeting mouse Gbp2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004120 Rosetta Predictions human pricing
NM_133624 Rosetta Predictions rat pricing
NM_010260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068017 predicted 2099
2 SASI_Hs01_00068018 predicted 1069
3 SASI_Hs01_00068019 predicted 728
4 SASI_Hs01_00068020 predicted 1895
5 SASI_Hs01_00068021 predicted 858
6 SASI_Hs01_00068023 predicted 913
7 SASI_Hs01_00068024 predicted 1693
8 SASI_Hs01_00068025 predicted 736
9 SASI_Hs01_00068026 predicted 1428
10 SASI_Hs02_00336967 predicted 2016
11 SASI_Hs01_00068022 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048495 predicted 1390
2 SASI_Rn01_00048496 predicted 1169
3 SASI_Rn01_00048498 predicted 1979
4 SASI_Rn02_00267852 predicted 620
5 SASI_Rn01_00048500 predicted 1024
6 SASI_Rn01_00048501 predicted 1242
7 SASI_Rn01_00048502 predicted 1859
8 SASI_Rn02_00267853 predicted 1818
9 SASI_Rn01_00048503 predicted 647
10 SASI_Rn02_00267854 predicted 1367
11 SASI_Rn01_00048497 predicted 1971
12 SASI_Rn01_00048499 predicted 627
13 SASI_Rn01_00048504 predicted 1675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044149 predicted 1722
2 SASI_Mm01_00044150 predicted 618
3 SASI_Mm01_00044151 predicted 591
4 SASI_Mm02_00318161 predicted 988
5 SASI_Mm01_00044152 predicted 812
6 SASI_Mm02_00318162 predicted 1564
7 SASI_Mm02_00318163 predicted 1806
8 SASI_Mm01_00044154 predicted 604
9 SASI_Mm01_00044155 predicted 1850
10 SASI_Mm02_00318164 predicted 1184
11 SASI_Mm01_00044153 predicted 1022
12 SASI_Mm01_00044156 predicted 1241
13 SASI_Mm01_00044157 predicted 1368
14 SASI_Mm01_00044158 predicted 671
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004120
GBP2 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein 2, interferon-inducible
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004120.3-759s21c1
Sequence:CCGGTAGACGACTCAGCTGACTTTGCTCGAGCAAAGTCAGCTGAGTCGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004120.3-1730s21c1
Sequence:CCGCATTGAAGTGGAACGTATAAAGCTCGAGCTTTATACGTTCCACTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004120.3-735s21c1
Sequence:CCGGACTCCTCACCTGGTAACAATTCTCGAGAATTGTTACCAGGTGAGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004120.3-1485s1c1
Sequence:CCGGGCATGGCTTTACTTCAGGATACTCGAGTATCCTGAAGTAAAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004120.3-874s1c1
Sequence:CCGGGCTTTCGCTAAAGCTAAGAAACTCGAGTTTCTTAGCTTTAGCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004120.3-1513s1c1
Sequence:CCGGCCCTTTAGAAGAAGATGTCAACTCGAGTTGACATCTTCTTCTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004120.3-2232s1c1
Sequence:CCGGGCAATTCAACTCATGCTTATTCTCGAGAATAAGCATGAGTTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004120.3-2026s1c1
Sequence:CCGGGCCAATATGTAACATACTCTACTCGAGTAGAGTATGTTACATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004120
GBP2 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein 2, interferon-inducible
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004120.3-759s21c1
Sequence:CCGGTAGACGACTCAGCTGACTTTGCTCGAGCAAAGTCAGCTGAGTCGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004120.3-1730s21c1
Sequence:CCGCATTGAAGTGGAACGTATAAAGCTCGAGCTTTATACGTTCCACTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004120.3-735s21c1
Sequence:CCGGACTCCTCACCTGGTAACAATTCTCGAGAATTGTTACCAGGTGAGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004120.3-1485s1c1
Sequence:CCGGGCATGGCTTTACTTCAGGATACTCGAGTATCCTGAAGTAAAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004120.3-874s1c1
Sequence:CCGGGCTTTCGCTAAAGCTAAGAAACTCGAGTTTCTTAGCTTTAGCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004120.3-1513s1c1
Sequence:CCGGCCCTTTAGAAGAAGATGTCAACTCGAGTTGACATCTTCTTCTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004120.3-2232s1c1
Sequence:CCGGGCAATTCAACTCATGCTTATTCTCGAGAATAAGCATGAGTTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004120.3-2026s1c1
Sequence:CCGGGCCAATATGTAACATACTCTACTCGAGTAGAGTATGTTACATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004120
GBP2 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein 2, interferon-inducible
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004120.3-759s21c1
Sequence:CCGGTAGACGACTCAGCTGACTTTGCTCGAGCAAAGTCAGCTGAGTCGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004120.3-1730s21c1
Sequence:CCGCATTGAAGTGGAACGTATAAAGCTCGAGCTTTATACGTTCCACTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004120.3-735s21c1
Sequence:CCGGACTCCTCACCTGGTAACAATTCTCGAGAATTGTTACCAGGTGAGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004120.3-1485s1c1
Sequence:CCGGGCATGGCTTTACTTCAGGATACTCGAGTATCCTGAAGTAAAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004120.3-874s1c1
Sequence:CCGGGCTTTCGCTAAAGCTAAGAAACTCGAGTTTCTTAGCTTTAGCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004120.3-1513s1c1
Sequence:CCGGCCCTTTAGAAGAAGATGTCAACTCGAGTTGACATCTTCTTCTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004120.3-2232s1c1
Sequence:CCGGGCAATTCAACTCATGCTTATTCTCGAGAATAAGCATGAGTTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004120.3-2026s1c1
Sequence:CCGGGCCAATATGTAACATACTCTACTCGAGTAGAGTATGTTACATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010260
VALIDATED
GBP2 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein 2, interferon-inducible
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010260.1-1773s21c1
Sequence:CCGGGACGAACAGAAACAGTTATTACTCGAGTAATAACTGTTTCTGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010260.1-1572s21c1
Sequence:CCGGGATGTTGTTGAAACACTTCTACTCGAGTAGAAGTGTTTCAACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010260.1-830s21c1
Sequence:CCGGGCGACTGTGCATCAGGAAATTCTCGAGAATTTCCTGATGCACAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010260.1-1387s21c1
Sequence:CCGGCAGACTTGCTGGAGGATATTTCTCGAGAAATATCCTCCAGCAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010260.1-2195s21c1
Sequence:CCGGGCCATACGTTTCTCCTGTATACTCGAGTATACAGGAGAAACGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010260.1-839s1c1
Sequence:CCGGCATCAGGAAATTCTTTCCAAACTCGAGTTTGGAAAGAATTTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010260.1-830s1c1
Sequence:CCGGGCGACTGTGCATCAGGAAATTCTCGAGAATTTCCTGATGCACAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010260.1-1572s1c1
Sequence:CCGGGATGTTGTTGAAACACTTCTACTCGAGTAGAAGTGTTTCAACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010260.1-1773s1c1
Sequence:CCGGGACGAACAGAAACAGTTATTACTCGAGTAATAACTGTTTCTGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010260.1-2195s1c1
Sequence:CCGGGCCATACGTTTCTCCTGTATACTCGAGTATACAGGAGAAACGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010260
VALIDATED
GBP2 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein 2, interferon-inducible
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010260.1-1773s21c1
Sequence:CCGGGACGAACAGAAACAGTTATTACTCGAGTAATAACTGTTTCTGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010260.1-1572s21c1
Sequence:CCGGGATGTTGTTGAAACACTTCTACTCGAGTAGAAGTGTTTCAACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010260.1-830s21c1
Sequence:CCGGGCGACTGTGCATCAGGAAATTCTCGAGAATTTCCTGATGCACAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010260.1-1387s21c1
Sequence:CCGGCAGACTTGCTGGAGGATATTTCTCGAGAAATATCCTCCAGCAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010260.1-2195s21c1
Sequence:CCGGGCCATACGTTTCTCCTGTATACTCGAGTATACAGGAGAAACGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010260.1-839s1c1
Sequence:CCGGCATCAGGAAATTCTTTCCAAACTCGAGTTTGGAAAGAATTTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010260.1-830s1c1
Sequence:CCGGGCGACTGTGCATCAGGAAATTCTCGAGAATTTCCTGATGCACAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010260.1-1572s1c1
Sequence:CCGGGATGTTGTTGAAACACTTCTACTCGAGTAGAAGTGTTTCAACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010260.1-1773s1c1
Sequence:CCGGGACGAACAGAAACAGTTATTACTCGAGTAATAACTGTTTCTGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010260.1-2195s1c1
Sequence:CCGGGCCATACGTTTCTCCTGTATACTCGAGTATACAGGAGAAACGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010260
VALIDATED
GBP2 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein 2, interferon-inducible
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010260.1-1773s21c1
Sequence:CCGGGACGAACAGAAACAGTTATTACTCGAGTAATAACTGTTTCTGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010260.1-1572s21c1
Sequence:CCGGGATGTTGTTGAAACACTTCTACTCGAGTAGAAGTGTTTCAACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010260.1-830s21c1
Sequence:CCGGGCGACTGTGCATCAGGAAATTCTCGAGAATTTCCTGATGCACAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010260.1-1387s21c1
Sequence:CCGGCAGACTTGCTGGAGGATATTTCTCGAGAAATATCCTCCAGCAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010260.1-2195s21c1
Sequence:CCGGGCCATACGTTTCTCCTGTATACTCGAGTATACAGGAGAAACGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010260.1-839s1c1
Sequence:CCGGCATCAGGAAATTCTTTCCAAACTCGAGTTTGGAAAGAATTTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010260.1-830s1c1
Sequence:CCGGGCGACTGTGCATCAGGAAATTCTCGAGAATTTCCTGATGCACAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010260.1-1572s1c1
Sequence:CCGGGATGTTGTTGAAACACTTCTACTCGAGTAGAAGTGTTTCAACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010260.1-1773s1c1
Sequence:CCGGGACGAACAGAAACAGTTATTACTCGAGTAATAACTGTTTCTGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010260.1-2195s1c1
Sequence:CCGGGCCATACGTTTCTCCTGTATACTCGAGTATACAGGAGAAACGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks