EMAIL THIS PAGE TO A FRIEND

GBP3

guanylate binding protein 3

Species: Human GBP3(2635), Mouse Gbp3(55932), Zebrafish gbp3(563072)
Gene ID:
Human(2635) Summary: This gene encodes a member of the guanylate-binding protein (GBP) family. GBPs specifically bind guanine nucleotides (GMP, GDP, and GTP) and contain two of the three consensus motifs found in typical GTP-binding proteins. The encoded protein interacts with a member of the germinal center kinase family. [provided by RefSeq, Jul 2008]
Mouse(55932) guanylate binding protein 3
Zebrafish(563072) guanylate binding protein 3
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018284 Rosetta Predictions human pricing
NM_018734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029138 predicted 1579
2 SASI_Hs01_00029139 predicted 782
3 SASI_Hs01_00029140 predicted 1344
4 SASI_Hs01_00029141 predicted 1718
5 SASI_Hs01_00029142 predicted 1390
6 SASI_Hs01_00029143 predicted 985
7 SASI_Hs01_00029144 predicted 1032
8 SASI_Hs01_00029145 predicted 1289
9 SASI_Hs02_00351663 predicted 232
10 SASI_Hs02_00351664 predicted 863
11 SASI_Hs01_00029146 predicted 754
12 SASI_Hs01_00029147 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323983 predicted 2098
2 SASI_Mm01_00082930 predicted 1693
3 SASI_Mm01_00082929 predicted 1924
4 SASI_Mm02_00323984 predicted 892
5 SASI_Mm01_00082931 predicted 1825
6 SASI_Mm02_00323985 predicted 1912
7 SASI_Mm02_00323986 predicted 359
8 SASI_Mm01_00082933 predicted 1008
9 SASI_Mm01_00082934 predicted 1116
10 SASI_Mm01_00082935 predicted 954
11 SASI_Mm01_00082932 predicted 1686
12 SASI_Mm01_00082936 predicted 2140
13 SASI_Mm01_00082937 predicted 2158
14 SASI_Mm01_00082938 predicted 1474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018284
VALIDATED
GBP3 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018284.2-1713s21c1
Sequence:CCGGTGGTGGAGGAAATGCAAATAACTCGAGTTATTTGCATTTCCTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018284.2-1975s21c1
Sequence:CCGGGCATAAGCTAAAGATCTAAACCTCGAGGTTTAGATCTTTAGCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018284.2-1864s21c1
Sequence:CCGGGGAACAGGCCCGAGTACTAAACTCGAGTTTAGTACTCGGGCCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018284.2-1082s21c1
Sequence:CCGGAGCCTAGTGCTGACCTATATCCTCGAGGATATAGGTCAGCACTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018284.2-402s21c1
Sequence:CCGGCTCTGGGCTCCACAGTGAAATCTCGAGATTTCACTGTGGAGCCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018284.2-1285s21c1
Sequence:CCGGGGAGGCCACTGAAGTCTATATCTCGAGATATAGACTTCAGTGGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018284.1-1919s1c1
Sequence:CCGGCCCAAGGCATAACTGAAACAACTCGAGTTGTTTCAGTTATGCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018284.1-876s1c1
Sequence:CCGGCCTGAATTTGTGCAACAAGTACTCGAGTACTTGTTGCACAAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018284.1-1481s1c1
Sequence:CCGGGCAGACATACTTGAAATCCAACTCGAGTTGGATTTCAAGTATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018284.1-1920s1c1
Sequence:CCGGCCAAGGCATAACTGAAACAATCTCGAGATTGTTTCAGTTATGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018284.1-1746s1c1
Sequence:CCGGCTCACTAGTAAACTTCAGGAACTCGAGTTCCTGAAGTTTACTAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018284
VALIDATED
GBP3 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018284.2-1713s21c1
Sequence:CCGGTGGTGGAGGAAATGCAAATAACTCGAGTTATTTGCATTTCCTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018284.2-1975s21c1
Sequence:CCGGGCATAAGCTAAAGATCTAAACCTCGAGGTTTAGATCTTTAGCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018284.2-1864s21c1
Sequence:CCGGGGAACAGGCCCGAGTACTAAACTCGAGTTTAGTACTCGGGCCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018284.2-1082s21c1
Sequence:CCGGAGCCTAGTGCTGACCTATATCCTCGAGGATATAGGTCAGCACTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018284.2-402s21c1
Sequence:CCGGCTCTGGGCTCCACAGTGAAATCTCGAGATTTCACTGTGGAGCCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018284.2-1285s21c1
Sequence:CCGGGGAGGCCACTGAAGTCTATATCTCGAGATATAGACTTCAGTGGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018284.1-1919s1c1
Sequence:CCGGCCCAAGGCATAACTGAAACAACTCGAGTTGTTTCAGTTATGCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018284.1-876s1c1
Sequence:CCGGCCTGAATTTGTGCAACAAGTACTCGAGTACTTGTTGCACAAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018284.1-1481s1c1
Sequence:CCGGGCAGACATACTTGAAATCCAACTCGAGTTGGATTTCAAGTATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018284.1-1920s1c1
Sequence:CCGGCCAAGGCATAACTGAAACAATCTCGAGATTGTTTCAGTTATGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018284.1-1746s1c1
Sequence:CCGGCTCACTAGTAAACTTCAGGAACTCGAGTTCCTGAAGTTTACTAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018284
VALIDATED
GBP3 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018284.2-1713s21c1
Sequence:CCGGTGGTGGAGGAAATGCAAATAACTCGAGTTATTTGCATTTCCTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018284.2-1975s21c1
Sequence:CCGGGCATAAGCTAAAGATCTAAACCTCGAGGTTTAGATCTTTAGCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018284.2-1864s21c1
Sequence:CCGGGGAACAGGCCCGAGTACTAAACTCGAGTTTAGTACTCGGGCCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018284.2-1082s21c1
Sequence:CCGGAGCCTAGTGCTGACCTATATCCTCGAGGATATAGGTCAGCACTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018284.2-402s21c1
Sequence:CCGGCTCTGGGCTCCACAGTGAAATCTCGAGATTTCACTGTGGAGCCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018284.2-1285s21c1
Sequence:CCGGGGAGGCCACTGAAGTCTATATCTCGAGATATAGACTTCAGTGGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018284.1-1919s1c1
Sequence:CCGGCCCAAGGCATAACTGAAACAACTCGAGTTGTTTCAGTTATGCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018284.1-876s1c1
Sequence:CCGGCCTGAATTTGTGCAACAAGTACTCGAGTACTTGTTGCACAAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018284.1-1481s1c1
Sequence:CCGGGCAGACATACTTGAAATCCAACTCGAGTTGGATTTCAAGTATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018284.1-1920s1c1
Sequence:CCGGCCAAGGCATAACTGAAACAATCTCGAGATTGTTTCAGTTATGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018284.1-1746s1c1
Sequence:CCGGCTCACTAGTAAACTTCAGGAACTCGAGTTCCTGAAGTTTACTAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018734
GBP3 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018734.2-2407s1c1
Sequence:CCGGGCATCCATAAATCCTGTCAAACTCGAGTTTGACAGGATTTATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018734.2-500s1c1
Sequence:CCGGGCAATCCGAAACCAAGGGTATCTCGAGATACCCTTGGTTTCGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018734.2-2081s1c1
Sequence:CCGGCGTTGGCAATGCGTTCATTATCTCGAGATAATGAACGCATTGCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018734.2-794s1c1
Sequence:CCGGTGTAGGTTTCTTCCCAGACTTCTCGAGAAGTCTGGGAAGAAACCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018734.2-946s1c1
Sequence:CCGGCCAGAGAATGTATCAGATATTCTCGAGAATATCTGATACATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018734
GBP3 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018734.2-2407s1c1
Sequence:CCGGGCATCCATAAATCCTGTCAAACTCGAGTTTGACAGGATTTATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018734.2-500s1c1
Sequence:CCGGGCAATCCGAAACCAAGGGTATCTCGAGATACCCTTGGTTTCGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018734.2-2081s1c1
Sequence:CCGGCGTTGGCAATGCGTTCATTATCTCGAGATAATGAACGCATTGCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018734.2-794s1c1
Sequence:CCGGTGTAGGTTTCTTCCCAGACTTCTCGAGAAGTCTGGGAAGAAACCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018734.2-946s1c1
Sequence:CCGGCCAGAGAATGTATCAGATATTCTCGAGAATATCTGATACATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018734
GBP3 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018734.2-2407s1c1
Sequence:CCGGGCATCCATAAATCCTGTCAAACTCGAGTTTGACAGGATTTATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018734.2-500s1c1
Sequence:CCGGGCAATCCGAAACCAAGGGTATCTCGAGATACCCTTGGTTTCGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018734.2-2081s1c1
Sequence:CCGGCGTTGGCAATGCGTTCATTATCTCGAGATAATGAACGCATTGCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018734.2-794s1c1
Sequence:CCGGTGTAGGTTTCTTCCCAGACTTCTCGAGAAGTCTGGGAAGAAACCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018734.2-946s1c1
Sequence:CCGGCCAGAGAATGTATCAGATATTCTCGAGAATATCTGATACATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks