EMAIL THIS PAGE TO A FRIEND

GBP4

guanylate binding protein 4

51 Gene Product Result for
Synonyms: Mpa2
UniProtKB ID: Q96PP9, B2R630, Q05D63, Q6NSL0, Q86T99
Gene ID:
Human(115361) Summary: Guanylate-binding proteins, such as GBP4, are induced by interferon and hydrolyze GTP to both GDP and GMP (Vestal, 2005 [PubMed 16108726]
Mouse(17472) guanylate binding protein 4
Rat(310917) guanylate binding protein 4
Zebrafish(100001368) guanylate binding protein 4
cow(613313) guanylate binding protein 4
cow(100298387) guanylate binding protein 4
Horse(100061885) guanylate binding protein 4
domestic guinea pig(100713243) guanylate binding protein 4
naked mole-rat(101698926) guanylate binding protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052941 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008620 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008620 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008620 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052941 Rosetta Predictions human pricing
XM_001078892 Rosetta Predictions rat pricing
XM_227762 Rosetta Predictions rat pricing
NM_008620 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177259 predicted 344
2 SASI_Hs01_00177260 predicted 797
3 SASI_Hs01_00177261 predicted 1884
4 SASI_Hs01_00177262 predicted 1955
5 SASI_Hs01_00177263 predicted 240
6 SASI_Hs01_00177264 predicted 1912
7 SASI_Hs01_00177265 predicted 1316
8 SASI_Hs01_00177266 predicted 1923
9 SASI_Hs01_00177267 predicted 1883
10 SASI_Hs01_00177268 predicted 1416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362370 predicted 491
2 SASI_Rn02_00362371 predicted 710
3 SASI_Rn02_00362372 predicted 781
4 SASI_Rn02_00362373 predicted 930
5 SASI_Rn02_00362374 predicted 824
6 SASI_Rn02_00362375 predicted 548
7 SASI_Rn02_00362376 predicted 471
8 SASI_Rn02_00362377 predicted 482
9 SASI_Rn02_00362378 predicted 858
10 SASI_Rn02_00362379 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384694 predicted 492
2 SASI_Rn02_00384695 predicted 712
3 SASI_Rn02_00384696 predicted 777
4 SASI_Rn02_00384697 predicted 930
5 SASI_Rn02_00384698 predicted 821
6 SASI_Rn02_00384699 predicted 541
7 SASI_Rn02_00384700 predicted 479
8 SASI_Rn02_00384701 predicted 475
9 SASI_Rn02_00384702 predicted 857
10 SASI_Rn02_00384703 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008620 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138580 predicted 1234
2 SASI_Mm01_00138581 predicted 705
3 SASI_Mm01_00138582 predicted 1838
4 SASI_Mm01_00138585 predicted 847
5 SASI_Mm01_00138586 predicted 1233
6 SASI_Mm01_00138588 predicted 786
7 SASI_Mm01_00138589 predicted 1802
8 SASI_Mm02_00314301 predicted 837
9 SASI_Mm01_00138583 predicted 1961
10 SASI_Mm01_00138584 predicted 1965
11 SASI_Mm01_00138587 predicted 1539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052941
GBP4 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-1408s1c1
Sequence:CCGGGAAACAGGTTGAGTGGGACTACTCGAGTAGTCCCACTCAACCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052941.2-3857s1c1
Sequence:CCGGCCCAGTTTCAATCTTCTGCATCTCGAGATGCAGAAGATTGAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052941.2-3733s1c1
Sequence:CCGGGCCAAGTCTTATGTCCAGAATCTCGAGATTCTGGACATAAGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052941.2-874s1c1
Sequence:CCGGCCTTATGCAATCAGACAACTTCTCGAGAAGTTGTCTGATTGCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-600s1c1
Sequence:CCGGCGAGTTTCTTTCCAGACTTTACTCGAGTAAAGTCTGGAAAGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052941.2-1864s1c1
Sequence:CCGGGCTCTTAAAGATCCTTGACATCTCGAGATGTCAAGGATCTTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052941.2-3858s1c1
Sequence:CCGGCCAGTTTCAATCTTCTGCATACTCGAGTATGCAGAAGATTGAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-465s1c1
Sequence:CCGGGCTTTGTCTATAACAGCGTGACTCGAGTCACGCTGTTATAGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-599s1c1
Sequence:CCGGGCGAGTTTCTTTCCAGACTTTCTCGAGAAAGTCTGGAAAGAAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-1919s1c1
Sequence:CCGGGCTTCCAAGCTACTTGGAGTACTCGAGTACTCCAAGTAGCTTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052941
GBP4 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-1408s1c1
Sequence:CCGGGAAACAGGTTGAGTGGGACTACTCGAGTAGTCCCACTCAACCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052941.2-3857s1c1
Sequence:CCGGCCCAGTTTCAATCTTCTGCATCTCGAGATGCAGAAGATTGAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052941.2-3733s1c1
Sequence:CCGGGCCAAGTCTTATGTCCAGAATCTCGAGATTCTGGACATAAGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052941.2-874s1c1
Sequence:CCGGCCTTATGCAATCAGACAACTTCTCGAGAAGTTGTCTGATTGCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-600s1c1
Sequence:CCGGCGAGTTTCTTTCCAGACTTTACTCGAGTAAAGTCTGGAAAGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052941.2-1864s1c1
Sequence:CCGGGCTCTTAAAGATCCTTGACATCTCGAGATGTCAAGGATCTTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052941.2-3858s1c1
Sequence:CCGGCCAGTTTCAATCTTCTGCATACTCGAGTATGCAGAAGATTGAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-465s1c1
Sequence:CCGGGCTTTGTCTATAACAGCGTGACTCGAGTCACGCTGTTATAGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-599s1c1
Sequence:CCGGGCGAGTTTCTTTCCAGACTTTCTCGAGAAAGTCTGGAAAGAAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-1919s1c1
Sequence:CCGGGCTTCCAAGCTACTTGGAGTACTCGAGTACTCCAAGTAGCTTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052941
GBP4 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-1408s1c1
Sequence:CCGGGAAACAGGTTGAGTGGGACTACTCGAGTAGTCCCACTCAACCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052941.2-3857s1c1
Sequence:CCGGCCCAGTTTCAATCTTCTGCATCTCGAGATGCAGAAGATTGAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052941.2-3733s1c1
Sequence:CCGGGCCAAGTCTTATGTCCAGAATCTCGAGATTCTGGACATAAGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052941.2-874s1c1
Sequence:CCGGCCTTATGCAATCAGACAACTTCTCGAGAAGTTGTCTGATTGCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-600s1c1
Sequence:CCGGCGAGTTTCTTTCCAGACTTTACTCGAGTAAAGTCTGGAAAGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052941.2-1864s1c1
Sequence:CCGGGCTCTTAAAGATCCTTGACATCTCGAGATGTCAAGGATCTTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052941.2-3858s1c1
Sequence:CCGGCCAGTTTCAATCTTCTGCATACTCGAGTATGCAGAAGATTGAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-465s1c1
Sequence:CCGGGCTTTGTCTATAACAGCGTGACTCGAGTCACGCTGTTATAGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-599s1c1
Sequence:CCGGGCGAGTTTCTTTCCAGACTTTCTCGAGAAAGTCTGGAAAGAAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052941.2-1919s1c1
Sequence:CCGGGCTTCCAAGCTACTTGGAGTACTCGAGTACTCCAAGTAGCTTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008620
GBP4 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008620.2-704s1c1
Sequence:CCGGCCCAGGTAACAATCCCAGAATCTCGAGATTCTGGGATTGTTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008620.2-2340s1c1
Sequence:CCGGCGGTAGAAAGAAGAAATCAAACTCGAGTTTGATTTCTTCTTTCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008620.2-1242s1c1
Sequence:CCGGCTACGTGAGAAGAATGGGCTTCTCGAGAAGCCCATTCTTCTCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008620.2-859s1c1
Sequence:CCGGCTACGTTTAAGGAAAGTGCAACTCGAGTTGCACTTTCCTTAAACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008620.2-1845s1c1
Sequence:CCGGGATTCCCTTGTGGAAAGTATTCTCGAGAATACTTTCCACAAGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008620
GBP4 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008620.2-704s1c1
Sequence:CCGGCCCAGGTAACAATCCCAGAATCTCGAGATTCTGGGATTGTTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008620.2-2340s1c1
Sequence:CCGGCGGTAGAAAGAAGAAATCAAACTCGAGTTTGATTTCTTCTTTCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008620.2-1242s1c1
Sequence:CCGGCTACGTGAGAAGAATGGGCTTCTCGAGAAGCCCATTCTTCTCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008620.2-859s1c1
Sequence:CCGGCTACGTTTAAGGAAAGTGCAACTCGAGTTGCACTTTCCTTAAACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008620.2-1845s1c1
Sequence:CCGGGATTCCCTTGTGGAAAGTATTCTCGAGAATACTTTCCACAAGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008620
GBP4 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008620.2-704s1c1
Sequence:CCGGCCCAGGTAACAATCCCAGAATCTCGAGATTCTGGGATTGTTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008620.2-2340s1c1
Sequence:CCGGCGGTAGAAAGAAGAAATCAAACTCGAGTTTGATTTCTTCTTTCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008620.2-1242s1c1
Sequence:CCGGCTACGTGAGAAGAATGGGCTTCTCGAGAAGCCCATTCTTCTCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008620.2-859s1c1
Sequence:CCGGCTACGTTTAAGGAAAGTGCAACTCGAGTTGCACTTTCCTTAAACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008620.2-1845s1c1
Sequence:CCGGGATTCCCTTGTGGAAAGTATTCTCGAGAATACTTTCCACAAGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks