EMAIL THIS PAGE TO A FRIEND

GBP5

guanylate binding protein 5

56 Gene Product Result for
Synonyms: GBP-5
UniProtKB ID: Q96PP8, B2RCE1, Q86TM5
Gene ID:
Mouse(229898) guanylate binding protein 5
Rat(362050) guanylate binding protein 5
naked mole-rat(101698564) guanylate binding protein 5
domestic guinea pig(100714902) guanylate binding protein 5
sheep(101120367) guanylate binding protein 5
domestic cat(101094195) guanylate binding protein 5
dog(490170) guanylate binding protein 5
cow(516949) guanylate binding protein 5
Horse(100061762) guanylate binding protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_212440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_212440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_212440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052942 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052942 Rosetta Predictions human pricing
NM_001108569 Rosetta Predictions rat pricing
NM_153564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229085 predicted 842
2 SASI_Hs01_00229086 predicted 1371
3 SASI_Hs01_00229087 predicted 950
4 SASI_Hs01_00229088 predicted 926
5 SASI_Hs01_00229089 predicted 1046
6 SASI_Hs01_00229090 predicted 625
7 SASI_Hs01_00229091 predicted 859
8 SASI_Hs01_00229093 predicted 1727
9 SASI_Hs01_00229094 predicted 897
10 SASI_Hs02_00361728 predicted 1092
11 SASI_Hs01_00229092 predicted 1311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239929 predicted 514
2 SASI_Rn02_00239930 predicted 1292
3 SASI_Rn02_00239931 predicted 1003
4 SASI_Rn02_00239932 predicted 1237
5 SASI_Rn02_00239933 predicted 1288
6 SASI_Rn02_00239934 predicted 1238
7 SASI_Rn02_00239935 predicted 1137
8 SASI_Rn02_00239936 predicted 1320
9 SASI_Rn02_00239937 predicted 1939
10 SASI_Rn02_00239938 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343359 predicted 874
2 SASI_Mm01_00073366 predicted 479
3 SASI_Mm01_00073367 predicted 430
4 SASI_Mm02_00343360 predicted 429
5 SASI_Mm01_00073368 predicted 1239
6 SASI_Mm01_00073370 predicted 1144
7 SASI_Mm01_00073371 predicted 862
8 SASI_Mm01_00073372 predicted 1207
9 SASI_Mm01_00073373 predicted 389
10 SASI_Mm01_00073374 predicted 1636
11 SASI_Mm01_00073369 predicted 498
12 SASI_Mm01_00073375 predicted 1797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212440
GBP5 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212440.1-3347s1c1
Sequence:CCGGCCCAGGTATATTGCTCACTTTCTCGAGAAAGTGAGCAATATACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212440.1-1330s1c1
Sequence:CCGGGCGCAGGAGTTCTATCATAAACTCGAGTTTATGATAGAACTCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212440.1-523s1c1
Sequence:CCGGCGGACAAGAAACTCCTCTGATCTCGAGATCAGAGGAGTTTCTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212440.1-429s1c1
Sequence:CCGGCCTCAGTAGCACCTTTGTATACTCGAGTATACAAAGGTGCTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212440.1-1446s1c1
Sequence:CCGGGCAGACCTATTTGAACGCCAACTCGAGTTGGCGTTCAAATAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212440
GBP5 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212440.1-3347s1c1
Sequence:CCGGCCCAGGTATATTGCTCACTTTCTCGAGAAAGTGAGCAATATACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212440.1-1330s1c1
Sequence:CCGGGCGCAGGAGTTCTATCATAAACTCGAGTTTATGATAGAACTCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212440.1-523s1c1
Sequence:CCGGCGGACAAGAAACTCCTCTGATCTCGAGATCAGAGGAGTTTCTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212440.1-429s1c1
Sequence:CCGGCCTCAGTAGCACCTTTGTATACTCGAGTATACAAAGGTGCTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212440.1-1446s1c1
Sequence:CCGGGCAGACCTATTTGAACGCCAACTCGAGTTGGCGTTCAAATAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212440
GBP5 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212440.1-3347s1c1
Sequence:CCGGCCCAGGTATATTGCTCACTTTCTCGAGAAAGTGAGCAATATACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212440.1-1330s1c1
Sequence:CCGGGCGCAGGAGTTCTATCATAAACTCGAGTTTATGATAGAACTCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212440.1-523s1c1
Sequence:CCGGCGGACAAGAAACTCCTCTGATCTCGAGATCAGAGGAGTTTCTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212440.1-429s1c1
Sequence:CCGGCCTCAGTAGCACCTTTGTATACTCGAGTATACAAAGGTGCTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212440.1-1446s1c1
Sequence:CCGGGCAGACCTATTTGAACGCCAACTCGAGTTGGCGTTCAAATAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052942
GBP5 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1872s1c1
Sequence:CCGGCGGAAAGGAATACAGGCTGAACTCGAGTTCAGCCTGTATTCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1995s1c1
Sequence:CCGGCAAGTGAAAGCAGAAGCTGAACTCGAGTTCAGCTTCTGCTTTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1184s1c1
Sequence:CCGGCCGTCTGTGTATACAGAAGTTCTCGAGAACTTCTGTATACACAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1146s1c1
Sequence:CCGGCAAGGTAGTGATCAAAGAGTTCTCGAGAACTCTTTGATCACTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1813s1c1
Sequence:CCGGGCCATAATCTCTTCATTCAGACTCGAGTCTGAATGAAGAGATTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1738s1c1
Sequence:CCGGGCTCGGCTTTACTTAAGGATACTCGAGTATCCTTAAGTAAAGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1281s1c1
Sequence:CCGGGATGATGAGCTAGAGCCTGAACTCGAGTTCAGGCTCTAGCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052942
GBP5 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1872s1c1
Sequence:CCGGCGGAAAGGAATACAGGCTGAACTCGAGTTCAGCCTGTATTCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1995s1c1
Sequence:CCGGCAAGTGAAAGCAGAAGCTGAACTCGAGTTCAGCTTCTGCTTTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1184s1c1
Sequence:CCGGCCGTCTGTGTATACAGAAGTTCTCGAGAACTTCTGTATACACAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1146s1c1
Sequence:CCGGCAAGGTAGTGATCAAAGAGTTCTCGAGAACTCTTTGATCACTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1813s1c1
Sequence:CCGGGCCATAATCTCTTCATTCAGACTCGAGTCTGAATGAAGAGATTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1738s1c1
Sequence:CCGGGCTCGGCTTTACTTAAGGATACTCGAGTATCCTTAAGTAAAGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1281s1c1
Sequence:CCGGGATGATGAGCTAGAGCCTGAACTCGAGTTCAGGCTCTAGCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052942
GBP5 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1872s1c1
Sequence:CCGGCGGAAAGGAATACAGGCTGAACTCGAGTTCAGCCTGTATTCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1995s1c1
Sequence:CCGGCAAGTGAAAGCAGAAGCTGAACTCGAGTTCAGCTTCTGCTTTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1184s1c1
Sequence:CCGGCCGTCTGTGTATACAGAAGTTCTCGAGAACTTCTGTATACACAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1146s1c1
Sequence:CCGGCAAGGTAGTGATCAAAGAGTTCTCGAGAACTCTTTGATCACTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1813s1c1
Sequence:CCGGGCCATAATCTCTTCATTCAGACTCGAGTCTGAATGAAGAGATTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1738s1c1
Sequence:CCGGGCTCGGCTTTACTTAAGGATACTCGAGTATCCTTAAGTAAAGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052942.2-1281s1c1
Sequence:CCGGGATGATGAGCTAGAGCCTGAACTCGAGTTCAGGCTCTAGCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153564
GBP5 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein 5
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000416124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153564.2-1468s21c1
Sequence:CCCGGAAACAGTGAGCCGTACAATTCTCGAGAATTGTACGGCTCACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153564.2-1209s21c1
Sequence:CCGGAGAATTGGAGAGCCTACTAAGCTCGAGCTTAGTAGGCTCTCCAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153564
GBP5 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein 5
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000416124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153564.2-1468s21c1
Sequence:CCCGGAAACAGTGAGCCGTACAATTCTCGAGAATTGTACGGCTCACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153564.2-1209s21c1
Sequence:CCGGAGAATTGGAGAGCCTACTAAGCTCGAGCTTAGTAGGCTCTCCAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153564
GBP5 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein 5
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000416124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153564.2-1468s21c1
Sequence:CCCGGAAACAGTGAGCCGTACAATTCTCGAGAATTGTACGGCTCACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153564.2-1209s21c1
Sequence:CCGGAGAATTGGAGAGCCTACTAAGCTCGAGCTTAGTAGGCTCTCCAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks