EMAIL THIS PAGE TO A FRIEND

GBP6

guanylate binding protein family, member 6

40 Gene Product Result for
UniProtKB ID: Q6ZN66, A2RRM3, Q6ZN86, Q7Z3F0
Gene ID:
Human(163351) Summary: Guanylate-binding proteins, such as GBP6, are induced by interferon and hydrolyze GTP to both GDP and GMP (Olszewski et al., 2006 [PubMed 16689661]
Mouse(100702) guanylate binding protein 6
cow(533657) guanylate binding protein family, member 6
Horse(100051962) guanylate binding protein family, member 6
cow(536917) guanylate binding protein family, member 6
domestic guinea pig(100714630) guanylate binding protein family, member 6
naked mole-rat(101698177) guanylate binding protein family, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198460 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_194336 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194336 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194336 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198460 Rosetta Predictions human pricing
NM_194336 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127767 predicted 1530
2 SASI_Hs02_00371983 predicted 352
3 SASI_Hs01_00127769 predicted 400
4 SASI_Hs02_00371984 predicted 1045
5 SASI_Hs01_00127770 predicted 712
6 SASI_Hs01_00127772 predicted 1946
7 SASI_Hs01_00127773 predicted 1701
8 SASI_Hs01_00127774 predicted 812
9 SASI_Hs01_00127775 predicted 1456
10 SASI_Hs01_00127776 predicted 1480
11 SASI_Hs01_00127768 predicted 1416
12 SASI_Hs01_00127771 predicted 1541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194336 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092803 predicted 696
2 SASI_Mm01_00092804 predicted 1351
3 SASI_Mm01_00092805 predicted 893
4 SASI_Mm02_00350615 predicted 1834
5 SASI_Mm01_00092806 predicted 1783
6 SASI_Mm01_00092807 predicted 1904
7 SASI_Mm01_00092809 predicted 1218
8 SASI_Mm01_00092811 predicted 1272
9 SASI_Mm02_00350616 predicted 1831
10 SASI_Mm02_00350617 predicted 1907
11 SASI_Mm01_00092802 predicted 547
12 SASI_Mm01_00092808 predicted 1841
13 SASI_Mm01_00092810 predicted 1838
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198460
GBP6 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein family, member 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-218s1c1
Sequence:CCGGCCATTGTAGGACTGTACCGTACTCGAGTACGGTACAGTCCTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-613s1c1
Sequence:CCGGCCAGACTTTCTTTGGACAGTACTCGAGTACTGTCCAAAGAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198460.1-2618s1c1
Sequence:CCGGGCCAGTAAACAAATTGACAATCTCGAGATTGTCAATTTGTTTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-808s1c2
Sequence:CCGGCCAACAAATGACAAAGACCTTCTCGAGAAGGTCTTTGTCATTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-1895s1c1
Sequence:CCGGCCGATGAGCTAACTGCAATATCTCGAGATATTGCAGTTAGCTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-1896s1c1
Sequence:CCGGCGATGAGCTAACTGCAATATTCTCGAGAATATTGCAGTTAGCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198460.1-2654s1c1
Sequence:CCGGCCAGTAAAGAATGGTCTTGAACTCGAGTTCAAGACCATTCTTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-1300s1c1
Sequence:CCGGGTTCAATACTGCCAGGCTAAACTCGAGTTTAGCCTGGCAGTATTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-1924s1c1
Sequence:CCGGCCTGCTAAATTAATTGGTCATCTCGAGATGACCAATTAATTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198460
GBP6 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein family, member 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-218s1c1
Sequence:CCGGCCATTGTAGGACTGTACCGTACTCGAGTACGGTACAGTCCTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-613s1c1
Sequence:CCGGCCAGACTTTCTTTGGACAGTACTCGAGTACTGTCCAAAGAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198460.1-2618s1c1
Sequence:CCGGGCCAGTAAACAAATTGACAATCTCGAGATTGTCAATTTGTTTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-808s1c2
Sequence:CCGGCCAACAAATGACAAAGACCTTCTCGAGAAGGTCTTTGTCATTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-1895s1c1
Sequence:CCGGCCGATGAGCTAACTGCAATATCTCGAGATATTGCAGTTAGCTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-1896s1c1
Sequence:CCGGCGATGAGCTAACTGCAATATTCTCGAGAATATTGCAGTTAGCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198460.1-2654s1c1
Sequence:CCGGCCAGTAAAGAATGGTCTTGAACTCGAGTTCAAGACCATTCTTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-1300s1c1
Sequence:CCGGGTTCAATACTGCCAGGCTAAACTCGAGTTTAGCCTGGCAGTATTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-1924s1c1
Sequence:CCGGCCTGCTAAATTAATTGGTCATCTCGAGATGACCAATTAATTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198460
GBP6 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein family, member 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-218s1c1
Sequence:CCGGCCATTGTAGGACTGTACCGTACTCGAGTACGGTACAGTCCTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-613s1c1
Sequence:CCGGCCAGACTTTCTTTGGACAGTACTCGAGTACTGTCCAAAGAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198460.1-2618s1c1
Sequence:CCGGGCCAGTAAACAAATTGACAATCTCGAGATTGTCAATTTGTTTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-808s1c2
Sequence:CCGGCCAACAAATGACAAAGACCTTCTCGAGAAGGTCTTTGTCATTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-1895s1c1
Sequence:CCGGCCGATGAGCTAACTGCAATATCTCGAGATATTGCAGTTAGCTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-1896s1c1
Sequence:CCGGCGATGAGCTAACTGCAATATTCTCGAGAATATTGCAGTTAGCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198460.1-2654s1c1
Sequence:CCGGCCAGTAAAGAATGGTCTTGAACTCGAGTTCAAGACCATTCTTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-1300s1c1
Sequence:CCGGGTTCAATACTGCCAGGCTAAACTCGAGTTTAGCCTGGCAGTATTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198460.1-1924s1c1
Sequence:CCGGCCTGCTAAATTAATTGGTCATCTCGAGATGACCAATTAATTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194336
GBP6 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein family, member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194336.1-2796s1c1
Sequence:CCGGGCTGGGAAAGTGACAGTGATACTCGAGTATCACTGTCACTTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194336.1-1835s1c1
Sequence:CCGGCGAATTAAGGATGCTCTCTTACTCGAGTAAGAGAGCATCCTTAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194336.1-245s1c1
Sequence:CCGGGCGGGACAGAATCACGGCTTTCTCGAGAAAGCCGTGATTCTGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194336.1-1886s1c1
Sequence:CCGGCTTGTCCGTTATCTAAAGCATCTCGAGATGCTTTAGATAACGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194336.1-541s1c1
Sequence:CCGGCCCAAATCTTGCTGGAATAAACTCGAGTTTATTCCAGCAAGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194336
GBP6 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein family, member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194336.1-2796s1c1
Sequence:CCGGGCTGGGAAAGTGACAGTGATACTCGAGTATCACTGTCACTTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194336.1-1835s1c1
Sequence:CCGGCGAATTAAGGATGCTCTCTTACTCGAGTAAGAGAGCATCCTTAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194336.1-245s1c1
Sequence:CCGGGCGGGACAGAATCACGGCTTTCTCGAGAAAGCCGTGATTCTGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194336.1-1886s1c1
Sequence:CCGGCTTGTCCGTTATCTAAAGCATCTCGAGATGCTTTAGATAACGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194336.1-541s1c1
Sequence:CCGGCCCAAATCTTGCTGGAATAAACTCGAGTTTATTCCAGCAAGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194336
GBP6 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein family, member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194336.1-2796s1c1
Sequence:CCGGGCTGGGAAAGTGACAGTGATACTCGAGTATCACTGTCACTTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194336.1-1835s1c1
Sequence:CCGGCGAATTAAGGATGCTCTCTTACTCGAGTAAGAGAGCATCCTTAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194336.1-245s1c1
Sequence:CCGGGCGGGACAGAATCACGGCTTTCTCGAGAAAGCCGTGATTCTGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194336.1-1886s1c1
Sequence:CCGGCTTGTCCGTTATCTAAAGCATCTCGAGATGCTTTAGATAACGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194336.1-541s1c1
Sequence:CCGGCCCAAATCTTGCTGGAATAAACTCGAGTTTATTCCAGCAAGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks