EMAIL THIS PAGE TO A FRIEND

GBP7

guanylate binding protein 7

45 Gene Product Result for
Synonyms: GBP4L
UniProtKB ID: Q8N8V2
Gene ID:
Human(388646) Summary: Guanylate-binding proteins, such as GBP7, are induced by interferon and hydrolyze GTP to both GDP and GMP (Olszewski et al., 2006 [PubMed 16689661]
Mouse(229900) guanylate binding protein 7
chicken(429696) guanylate binding protein 7
dog(490169) guanylate binding protein 7
cow(513659) guanylate binding protein 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207398 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU080631 MISSION® esiRNA esiRNA targeting mouse Gbp6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207398 Rosetta Predictions human pricing
NM_001083312 Rosetta Predictions mouse pricing
NM_145545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053985 predicted 1972
2 SASI_Hs01_00053987 predicted 345
3 SASI_Hs01_00053988 predicted 1600
4 SASI_Hs01_00053989 predicted 1395
5 SASI_Hs01_00053990 predicted 1937
6 SASI_Hs01_00053991 predicted 246
7 SASI_Hs01_00053992 predicted 1369
8 SASI_Hs01_00053993 predicted 198
9 SASI_Hs01_00053994 predicted 1383
10 SASI_Hs02_00374011 predicted 2145
11 SASI_Hs01_00053986 predicted 2112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299561 predicted 2113
2 SASI_Mm02_00299562 predicted 1504
3 SASI_Mm02_00299563 predicted 1820
4 SASI_Mm02_00299564 predicted 775
5 SASI_Mm02_00299565 predicted 1280
6 SASI_Mm02_00299566 predicted 1993
7 SASI_Mm02_00299567 predicted 373
8 SASI_Mm02_00299568 predicted 1028
9 SASI_Mm02_00299569 predicted 1524
10 SASI_Mm02_00299570 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131172 predicted 2127
2 SASI_Mm01_00131173 predicted 1514
3 SASI_Mm01_00131174 predicted 1832
4 SASI_Mm01_00131175 predicted 795
5 SASI_Mm01_00131177 predicted 1291
6 SASI_Mm01_00131178 predicted 2006
7 SASI_Mm01_00131179 predicted 386
8 SASI_Mm01_00131181 predicted 1046
9 SASI_Mm02_00341032 predicted 1532
10 SASI_Mm02_00341033 predicted 816
11 SASI_Mm01_00131176 predicted 549
12 SASI_Mm01_00131180 predicted 254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145545
VALIDATED
GBP7 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145545.2-2242s1c1
Sequence:CCGGCGGACATCTTTGGCACAGAATCTCGAGATTCTGTGCCAAAGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145545.2-1050s1c1
Sequence:CCGGCGTGTTTAGAGAACGCAGTAACTCGAGTTACTGCGTTCTCTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145545.2-822s1c1
Sequence:CCGGGCTTTGTCTTTGATCGACCTACTCGAGTAGGTCGATCAAAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145545.2-1768s1c1
Sequence:CCGGGCTGGAACACAAGTTGAAGATCTCGAGATCTTCAACTTGTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145545.2-1049s1c1
Sequence:CCGGCCGTGTTTAGAGAACGCAGTACTCGAGTACTGCGTTCTCTAAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145545.3-1766s21c1
Sequence:CCGGGCTGGAACACAAGTTGAAGATCTCGAGATCTTCAACTTGTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145545.3-820s21c1
Sequence:CCGGGCTTTGTCTTTGATCGACCTACTCGAGTAGGTCGATCAAAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145545.3-1047s21c1
Sequence:CCGGCCGTGTTTAGAGAACGCAGTACTCGAGTACTGCGTTCTCTAAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145545.3-2240s21c1
Sequence:CCGGCGGACATCTTTGGCACAGAATCTCGAGATTCTGTGCCAAAGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145545
VALIDATED
GBP7 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145545.2-2242s1c1
Sequence:CCGGCGGACATCTTTGGCACAGAATCTCGAGATTCTGTGCCAAAGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145545.2-1050s1c1
Sequence:CCGGCGTGTTTAGAGAACGCAGTAACTCGAGTTACTGCGTTCTCTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145545.2-822s1c1
Sequence:CCGGGCTTTGTCTTTGATCGACCTACTCGAGTAGGTCGATCAAAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145545.2-1768s1c1
Sequence:CCGGGCTGGAACACAAGTTGAAGATCTCGAGATCTTCAACTTGTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145545.2-1049s1c1
Sequence:CCGGCCGTGTTTAGAGAACGCAGTACTCGAGTACTGCGTTCTCTAAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145545.3-1766s21c1
Sequence:CCGGGCTGGAACACAAGTTGAAGATCTCGAGATCTTCAACTTGTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145545.3-820s21c1
Sequence:CCGGGCTTTGTCTTTGATCGACCTACTCGAGTAGGTCGATCAAAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145545.3-1047s21c1
Sequence:CCGGCCGTGTTTAGAGAACGCAGTACTCGAGTACTGCGTTCTCTAAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145545.3-2240s21c1
Sequence:CCGGCGGACATCTTTGGCACAGAATCTCGAGATTCTGTGCCAAAGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145545
VALIDATED
GBP7 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145545.2-2242s1c1
Sequence:CCGGCGGACATCTTTGGCACAGAATCTCGAGATTCTGTGCCAAAGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145545.2-1050s1c1
Sequence:CCGGCGTGTTTAGAGAACGCAGTAACTCGAGTTACTGCGTTCTCTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145545.2-822s1c1
Sequence:CCGGGCTTTGTCTTTGATCGACCTACTCGAGTAGGTCGATCAAAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145545.2-1768s1c1
Sequence:CCGGGCTGGAACACAAGTTGAAGATCTCGAGATCTTCAACTTGTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145545.2-1049s1c1
Sequence:CCGGCCGTGTTTAGAGAACGCAGTACTCGAGTACTGCGTTCTCTAAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145545.3-1766s21c1
Sequence:CCGGGCTGGAACACAAGTTGAAGATCTCGAGATCTTCAACTTGTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145545.3-820s21c1
Sequence:CCGGGCTTTGTCTTTGATCGACCTACTCGAGTAGGTCGATCAAAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145545.3-1047s21c1
Sequence:CCGGCCGTGTTTAGAGAACGCAGTACTCGAGTACTGCGTTCTCTAAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145545.3-2240s21c1
Sequence:CCGGCGGACATCTTTGGCACAGAATCTCGAGATTCTGTGCCAAAGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207398
GBP7 MISSION shRNA Bacterial Glycerol Stock
guanylate binding protein 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207398.1-2023s1c1
Sequence:CCGGGCTGAGAAATCCTGGTAAGAACTCGAGTTCTTACCAGGATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-1970s1c1
Sequence:CCGGGCTGCTAAGCTAGTTGATTTACTCGAGTAAATCAACTAGCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-1937s1c1
Sequence:CCGGGCTGGCAGTATATTTATTGCACTCGAGTGCAATAAATATACTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-2007s1c1
Sequence:CCGGGCTCATTATGTAATAGGCTGACTCGAGTCAGCCTATTACATAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-904s1c1
Sequence:CCGGCCAACTGGATAGTAATTTCCACTCGAGTGGAAATTACTATCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-1811s1c1
Sequence:CCGGGAACTGCTTACTGAAGGATTTCTCGAGAAATCCTTCAGTAAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207398.1-283s1c1
Sequence:CCGGCACAGGCAAATCCTACCTAATCTCGAGATTAGGTAGGATTTGCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207398.2-468s21c1
Sequence:CCGGAGAGTGACTCGTGGATCTTTGCTCGAGCAAAGATCCACGAGTCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207398.2-1243s21c1
Sequence:CCGGGGAGTACTCCTTCAAAGATAACTCGAGTTATCTTTGAAGGAGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207398.2-2229s21c1
Sequence:CCGGGGGAACAAGTTAGAAGATAAACTCGAGTTTATCTTCTAACTTGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207398
GBP7 MISSION shRNA shRNA Plasmid DNA
guanylate binding protein 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207398.1-2023s1c1
Sequence:CCGGGCTGAGAAATCCTGGTAAGAACTCGAGTTCTTACCAGGATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-1970s1c1
Sequence:CCGGGCTGCTAAGCTAGTTGATTTACTCGAGTAAATCAACTAGCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-1937s1c1
Sequence:CCGGGCTGGCAGTATATTTATTGCACTCGAGTGCAATAAATATACTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-2007s1c1
Sequence:CCGGGCTCATTATGTAATAGGCTGACTCGAGTCAGCCTATTACATAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-904s1c1
Sequence:CCGGCCAACTGGATAGTAATTTCCACTCGAGTGGAAATTACTATCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-1811s1c1
Sequence:CCGGGAACTGCTTACTGAAGGATTTCTCGAGAAATCCTTCAGTAAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207398.1-283s1c1
Sequence:CCGGCACAGGCAAATCCTACCTAATCTCGAGATTAGGTAGGATTTGCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207398.2-468s21c1
Sequence:CCGGAGAGTGACTCGTGGATCTTTGCTCGAGCAAAGATCCACGAGTCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207398.2-1243s21c1
Sequence:CCGGGGAGTACTCCTTCAAAGATAACTCGAGTTATCTTTGAAGGAGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207398.2-2229s21c1
Sequence:CCGGGGGAACAAGTTAGAAGATAAACTCGAGTTTATCTTCTAACTTGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207398
GBP7 MISSION shRNA Lentiviral Transduction Particles
guanylate binding protein 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207398.1-2023s1c1
Sequence:CCGGGCTGAGAAATCCTGGTAAGAACTCGAGTTCTTACCAGGATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-1970s1c1
Sequence:CCGGGCTGCTAAGCTAGTTGATTTACTCGAGTAAATCAACTAGCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-1937s1c1
Sequence:CCGGGCTGGCAGTATATTTATTGCACTCGAGTGCAATAAATATACTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-2007s1c1
Sequence:CCGGGCTCATTATGTAATAGGCTGACTCGAGTCAGCCTATTACATAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-904s1c1
Sequence:CCGGCCAACTGGATAGTAATTTCCACTCGAGTGGAAATTACTATCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207398.1-1811s1c1
Sequence:CCGGGAACTGCTTACTGAAGGATTTCTCGAGAAATCCTTCAGTAAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207398.1-283s1c1
Sequence:CCGGCACAGGCAAATCCTACCTAATCTCGAGATTAGGTAGGATTTGCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207398.2-468s21c1
Sequence:CCGGAGAGTGACTCGTGGATCTTTGCTCGAGCAAAGATCCACGAGTCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207398.2-1243s21c1
Sequence:CCGGGGAGTACTCCTTCAAAGATAACTCGAGTTATCTTTGAAGGAGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207398.2-2229s21c1
Sequence:CCGGGGGAACAAGTTAGAAGATAAACTCGAGTTTATCTTCTAACTTGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks