EMAIL THIS PAGE TO A FRIEND

GBX1

gastrulation brain homeobox 1

52 Gene Product Result for
Synonyms: Huh-17
UniProtKB ID: Q14549
Gene ID:
Mouse(231044) gastrulation brain homeobox 1
Rat(246149) gastrulation brain homeobox 1
sheep(101113844) gastrulation brain homeobox 1
domestic guinea pig(100713929) gastrulation brain homeobox 1
Zebrafish(142985) gastrulation brain homeobox 1
cow(518355) gastrulation brain homeobox 1
domestic cat(101082642) gastrulation brain homeobox 1
dog(610971) gastrulation brain homeobox 1
chicken(395377) gastrulation brain homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098834 Rosetta Predictions human pricing
XM_001060894 Rosetta Predictions rat pricing
XM_001063850 Rosetta Predictions rat pricing
NM_015739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320144 predicted 1009
2 SASI_Hs02_00320145 predicted 1055
3 SASI_Hs02_00320146 predicted 915
4 SASI_Hs02_00320147 predicted 921
5 SASI_Hs02_00320148 predicted 1011
6 SASI_Hs02_00320149 predicted 858
7 SASI_Hs02_00320150 predicted 871
8 SASI_Hs02_00320151 predicted 861
9 SASI_Hs02_00320152 predicted 1078
10 SASI_Hs02_00320153 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298075 predicted 483
2 SASI_Rn02_00298076 predicted 385
3 SASI_Rn02_00298077 predicted 386
4 SASI_Rn02_00298078 predicted 388
5 SASI_Rn02_00298079 predicted 532
6 SASI_Rn02_00298080 predicted 328
7 SASI_Rn02_00298081 predicted 341
8 SASI_Rn02_00298082 predicted 488
9 SASI_Rn02_00298083 predicted 485
10 SASI_Rn02_00298084 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308499 predicted 723
2 SASI_Rn02_00308500 predicted 623
3 SASI_Rn02_00308501 predicted 622
4 SASI_Rn02_00308502 predicted 622
5 SASI_Rn02_00308503 predicted 756
6 SASI_Rn02_00308504 predicted 565
7 SASI_Rn02_00308505 predicted 580
8 SASI_Rn02_00308506 predicted 722
9 SASI_Rn02_00308507 predicted 720
10 SASI_Rn02_00308508 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036340 predicted 1211
2 SASI_Mm01_00036341 predicted 1220
3 SASI_Mm01_00036342 predicted 887
4 SASI_Mm01_00036343 predicted 1077
5 SASI_Mm01_00036344 predicted 1151
6 SASI_Mm01_00036345 predicted 1087
7 SASI_Mm01_00036346 predicted 710
8 SASI_Mm01_00036347 predicted 756
9 SASI_Mm01_00036348 predicted 1149
10 SASI_Mm01_00036349 predicted 1048
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015739
GBX1 MISSION shRNA Bacterial Glycerol Stock
gastrulation brain homeobox 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-1200s1c1
Sequence:CCGGCCCAAGATTGTAGTGCCCATACTCGAGTATGGGCACTACAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-714s1c1
Sequence:CCGGTCTGAGACTTTCCCGAGTCTACTCGAGTAGACTCGGGAAAGTCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-704s1c1
Sequence:CCGGTCCGCACTTCTCTGAGACTTTCTCGAGAAAGTCTCAGAGAAGTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-74s1c1
Sequence:CCGGCCTCCCTCCTTATGAGCGAGACTCGAGTCTCGCTCATAAGGAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-886s1c1
Sequence:CCGGTGGGACCTAAACCGAAGCTAACTCGAGTTAGCTTCGGTTTAGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015739.2-1105s21c1
Sequence:CCGGTGCAGGTGAAGATCTGGTTTCCTCGAGGAAACCAGATCTTCACCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015739.2-282s21c1
Sequence:CCGGTTCTCCATCGACTCGCTCATCCTCGAGGATGAGCGAGTCGATGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015739.2-1030s21c1
Sequence:CCGGAGGAGTTTCACTGCAAGAAATCTCGAGATTTCTTGCAGTGAAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015739
GBX1 MISSION shRNA shRNA Plasmid DNA
gastrulation brain homeobox 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-1200s1c1
Sequence:CCGGCCCAAGATTGTAGTGCCCATACTCGAGTATGGGCACTACAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-714s1c1
Sequence:CCGGTCTGAGACTTTCCCGAGTCTACTCGAGTAGACTCGGGAAAGTCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-704s1c1
Sequence:CCGGTCCGCACTTCTCTGAGACTTTCTCGAGAAAGTCTCAGAGAAGTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-74s1c1
Sequence:CCGGCCTCCCTCCTTATGAGCGAGACTCGAGTCTCGCTCATAAGGAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-886s1c1
Sequence:CCGGTGGGACCTAAACCGAAGCTAACTCGAGTTAGCTTCGGTTTAGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015739.2-1105s21c1
Sequence:CCGGTGCAGGTGAAGATCTGGTTTCCTCGAGGAAACCAGATCTTCACCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015739.2-282s21c1
Sequence:CCGGTTCTCCATCGACTCGCTCATCCTCGAGGATGAGCGAGTCGATGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015739.2-1030s21c1
Sequence:CCGGAGGAGTTTCACTGCAAGAAATCTCGAGATTTCTTGCAGTGAAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015739
GBX1 MISSION shRNA Lentiviral Transduction Particles
gastrulation brain homeobox 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-1200s1c1
Sequence:CCGGCCCAAGATTGTAGTGCCCATACTCGAGTATGGGCACTACAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-714s1c1
Sequence:CCGGTCTGAGACTTTCCCGAGTCTACTCGAGTAGACTCGGGAAAGTCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-704s1c1
Sequence:CCGGTCCGCACTTCTCTGAGACTTTCTCGAGAAAGTCTCAGAGAAGTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-74s1c1
Sequence:CCGGCCTCCCTCCTTATGAGCGAGACTCGAGTCTCGCTCATAAGGAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015739.1-886s1c1
Sequence:CCGGTGGGACCTAAACCGAAGCTAACTCGAGTTAGCTTCGGTTTAGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015739.2-1105s21c1
Sequence:CCGGTGCAGGTGAAGATCTGGTTTCCTCGAGGAAACCAGATCTTCACCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015739.2-282s21c1
Sequence:CCGGTTCTCCATCGACTCGCTCATCCTCGAGGATGAGCGAGTCGATGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015739.2-1030s21c1
Sequence:CCGGAGGAGTTTCACTGCAAGAAATCTCGAGATTTCTTGCAGTGAAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks