EMAIL THIS PAGE TO A FRIEND

GBX2

gastrulation brain homeobox 2

65 Gene Product Result for
UniProtKB ID: P52951, B2RPH7, O43833, Q53RX5, Q9Y5Y1
Gene ID:
Mouse(14472) gastrulation brain homeobox 2
Rat(114500) gastrulation brain homeobox 2
Zebrafish(245948) gastrulation brain homeo box 2
chicken(395950) gastrulation brain homeobox 2
dog(486174) gastrulation brain homeobox 2
cow(507344) gastrulation brain homeobox 2
domestic cat(101086670) gastrulation brain homeobox 2
domestic guinea pig(100717483) gastrulation brain homeobox 2
sheep(101103768) gastrulation brain homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001485 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010262 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010262 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010262 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001485 Rosetta Predictions human pricing
XM_001066354 Rosetta Predictions rat pricing
XM_346072 Rosetta Predictions rat pricing
NM_010262 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155709 predicted 653
2 SASI_Hs01_00155710 predicted 955
3 SASI_Hs01_00155711 predicted 824
4 SASI_Hs02_00331966 predicted 1027
5 SASI_Hs01_00155712 predicted 1024
6 SASI_Hs01_00155713 predicted 955
7 SASI_Hs01_00155714 predicted 1043
8 SASI_Hs01_00155715 predicted 623
9 SASI_Hs01_00155716 predicted 1017
10 SASI_Hs01_00155717 predicted 877
11 SASI_Hs01_00155718 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317203 predicted 1137
2 SASI_Rn02_00317204 predicted 613
3 SASI_Rn02_00317205 predicted 992
4 SASI_Rn02_00317206 predicted 606
5 SASI_Rn02_00317207 predicted 989
6 SASI_Rn02_00317208 predicted 1213
7 SASI_Rn02_00317209 predicted 1099
8 SASI_Rn02_00317210 predicted 1102
9 SASI_Rn02_00317211 predicted 1248
10 SASI_Rn02_00317212 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399054 predicted 610
2 SASI_Rn02_00399055 predicted 600
3 SASI_Rn02_00399056 predicted 549
4 SASI_Rn02_00399057 predicted 431
5 SASI_Rn02_00399058 predicted 543
6 SASI_Rn02_00399059 predicted 427
7 SASI_Rn02_00399060 predicted 442
8 SASI_Rn02_00399061 predicted 414
9 SASI_Rn02_00399062 predicted 603
10 SASI_Rn02_00399063 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139347 predicted 1029
2 SASI_Mm01_00139348 predicted 1415
3 SASI_Mm01_00139349 predicted 1020
4 SASI_Mm01_00139350 predicted 1331
5 SASI_Mm01_00139351 predicted 1628
6 SASI_Mm02_00318166 predicted 1526
7 SASI_Mm01_00139352 predicted 1574
8 SASI_Mm01_00139353 predicted 1045
9 SASI_Mm01_00139354 predicted 1518
10 SASI_Mm02_00318167 predicted 1270
11 SASI_Mm01_00139355 predicted 1557
12 SASI_Mm01_00139356 predicted 1065
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001485
GBX2 MISSION shRNA Bacterial Glycerol Stock
gastrulation brain homeobox 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001485.2-1027s21c1
Sequence:CCGGACGTCAGCAGGTTCGCTATCACTCGAGTGATAGCGAACCTGCTGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001485.2-95s21c1
Sequence:CCGGCACCGCCTTCAGCATAGACTCCTCGAGGAGTCTATGCTGAAGGCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001485.2-650s21c1
Sequence:CCGGTGTGGACTACAGCTCGGATGACTCGAGTCATCCGAGCTGTAGTCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001485.2-1157s1c1
Sequence:CCGGCCACTGTGTTTGAAGCAACAACTCGAGTTGTTGCTTCAAACACAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001485.2-578s1c1
Sequence:CCGGGCAAGGGAAAGACGAGTCAAACTCGAGTTTGACTCGTCTTTCCCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001485.2-149s1c1
Sequence:CCGGCCATTTCGTCTACACCGGCTACTCGAGTAGCCGGTGTAGACGAAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001485.2-758s1c1
Sequence:CCGGCACCACGTCTACGGGCAAGAACTCGAGTTCTTGCCCGTAGACGTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001485.2-1040s1c1
Sequence:CCGGCGCTATCAGAAGTCAGCATCACTCGAGTGATGCTGACTTCTGATAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001485
GBX2 MISSION shRNA shRNA Plasmid DNA
gastrulation brain homeobox 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001485.2-1027s21c1
Sequence:CCGGACGTCAGCAGGTTCGCTATCACTCGAGTGATAGCGAACCTGCTGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001485.2-95s21c1
Sequence:CCGGCACCGCCTTCAGCATAGACTCCTCGAGGAGTCTATGCTGAAGGCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001485.2-650s21c1
Sequence:CCGGTGTGGACTACAGCTCGGATGACTCGAGTCATCCGAGCTGTAGTCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001485.2-1157s1c1
Sequence:CCGGCCACTGTGTTTGAAGCAACAACTCGAGTTGTTGCTTCAAACACAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001485.2-578s1c1
Sequence:CCGGGCAAGGGAAAGACGAGTCAAACTCGAGTTTGACTCGTCTTTCCCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001485.2-149s1c1
Sequence:CCGGCCATTTCGTCTACACCGGCTACTCGAGTAGCCGGTGTAGACGAAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001485.2-758s1c1
Sequence:CCGGCACCACGTCTACGGGCAAGAACTCGAGTTCTTGCCCGTAGACGTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001485.2-1040s1c1
Sequence:CCGGCGCTATCAGAAGTCAGCATCACTCGAGTGATGCTGACTTCTGATAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001485
GBX2 MISSION shRNA Lentiviral Transduction Particles
gastrulation brain homeobox 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001485.2-1027s21c1
Sequence:CCGGACGTCAGCAGGTTCGCTATCACTCGAGTGATAGCGAACCTGCTGACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001485.2-95s21c1
Sequence:CCGGCACCGCCTTCAGCATAGACTCCTCGAGGAGTCTATGCTGAAGGCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001485.2-650s21c1
Sequence:CCGGTGTGGACTACAGCTCGGATGACTCGAGTCATCCGAGCTGTAGTCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001485.2-1157s1c1
Sequence:CCGGCCACTGTGTTTGAAGCAACAACTCGAGTTGTTGCTTCAAACACAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001485.2-578s1c1
Sequence:CCGGGCAAGGGAAAGACGAGTCAAACTCGAGTTTGACTCGTCTTTCCCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001485.2-149s1c1
Sequence:CCGGCCATTTCGTCTACACCGGCTACTCGAGTAGCCGGTGTAGACGAAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001485.2-758s1c1
Sequence:CCGGCACCACGTCTACGGGCAAGAACTCGAGTTCTTGCCCGTAGACGTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001485.2-1040s1c1
Sequence:CCGGCGCTATCAGAAGTCAGCATCACTCGAGTGATGCTGACTTCTGATAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010262
GBX2 MISSION shRNA Bacterial Glycerol Stock
gastrulation brain homeobox 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010262.3-1276s21c1
Sequence:CCGGACTCAGCGAGGTGCAAGTAAACTCGAGTTTACTTGCACCTCGCTGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010262.3-1915s21c1
Sequence:CCGGTGCAGAGCAGTCGGTTGATTTCTCGAGAAATCAACCGACTGCTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-1031s1c1
Sequence:CCGGGATGTGGATTACAGCTCAGATCTCGAGATCTGAGCTGTAATCCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-1408s1c1
Sequence:CCGGTCACGTTAGCAGGTTCGCTATCTCGAGATAGCGAACCTGCTAACGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-1060s1c1
Sequence:CCGGGCCTGGTCAGACTGCTCATAACTCGAGTTATGAGCAGTCTGACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-1172s1c1
Sequence:CCGGCGGACTGCCTTCACCAGCGAACTCGAGTTCGCTGGTGAAGGCAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-973s1c1
Sequence:CCGGCGAGTCAAAGGTGGAAGATGACTCGAGTCATCTTCCACCTTTGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010262
GBX2 MISSION shRNA shRNA Plasmid DNA
gastrulation brain homeobox 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010262.3-1276s21c1
Sequence:CCGGACTCAGCGAGGTGCAAGTAAACTCGAGTTTACTTGCACCTCGCTGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010262.3-1915s21c1
Sequence:CCGGTGCAGAGCAGTCGGTTGATTTCTCGAGAAATCAACCGACTGCTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-1031s1c1
Sequence:CCGGGATGTGGATTACAGCTCAGATCTCGAGATCTGAGCTGTAATCCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-1408s1c1
Sequence:CCGGTCACGTTAGCAGGTTCGCTATCTCGAGATAGCGAACCTGCTAACGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-1060s1c1
Sequence:CCGGGCCTGGTCAGACTGCTCATAACTCGAGTTATGAGCAGTCTGACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-1172s1c1
Sequence:CCGGCGGACTGCCTTCACCAGCGAACTCGAGTTCGCTGGTGAAGGCAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-973s1c1
Sequence:CCGGCGAGTCAAAGGTGGAAGATGACTCGAGTCATCTTCCACCTTTGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010262
GBX2 MISSION shRNA Lentiviral Transduction Particles
gastrulation brain homeobox 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010262.3-1276s21c1
Sequence:CCGGACTCAGCGAGGTGCAAGTAAACTCGAGTTTACTTGCACCTCGCTGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010262.3-1915s21c1
Sequence:CCGGTGCAGAGCAGTCGGTTGATTTCTCGAGAAATCAACCGACTGCTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-1031s1c1
Sequence:CCGGGATGTGGATTACAGCTCAGATCTCGAGATCTGAGCTGTAATCCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-1408s1c1
Sequence:CCGGTCACGTTAGCAGGTTCGCTATCTCGAGATAGCGAACCTGCTAACGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-1060s1c1
Sequence:CCGGGCCTGGTCAGACTGCTCATAACTCGAGTTATGAGCAGTCTGACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-1172s1c1
Sequence:CCGGCGGACTGCCTTCACCAGCGAACTCGAGTTCGCTGGTGAAGGCAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010262.2-973s1c1
Sequence:CCGGCGAGTCAAAGGTGGAAGATGACTCGAGTCATCTTCCACCTTTGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)