EMAIL THIS PAGE TO A FRIEND

GC

group-specific component (vitamin D binding protein)

65 Gene Product Result for
Synonyms: DBP DBP/GC GRD3 VDBG VDBP
Gene ID:
Human(2638) Summary: The protein encoded by this gene belongs to the albumin gene family. It is a multifunctional protein found in plasma, ascitic fluid, cerebrospinal fluid and on the surface of many cell types. It binds to vitamin D and its plasma metabolites and transports them to target tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
Mouse(14473) group specific component
Rat(24384) group specific component
sheep(101102644) group-specific component (vitamin D binding protein)
domestic guinea pig(100730070) group-specific component (vitamin D binding protein)
naked mole-rat(101724084) group-specific component (vitamin D binding protein)
Zebrafish(436841) group-specific component (vitamin D binding protein)
cow(530076) group-specific component (vitamin D binding protein)
domestic cat(101096313) group-specific component (vitamin D binding protein)
chicken(395696) group-specific component (vitamin D binding protein)
fruit fly(38194) gamma-glutamyl carboxylase
dog(475172) group-specific component (vitamin D binding protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0556 AQUA Peptide ELSSFID[K] human pricing
AQ0557 AQUA Peptide THLPEVFLS[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000583 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008096 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008096 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008096 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011421 MISSION® esiRNA esiRNA targeting human GC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000583 Rosetta Predictions human pricing
NM_012564 Rosetta Predictions rat pricing
NM_008096 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078090 predicted 1238
2 SASI_Hs01_00078091 predicted 1179
3 SASI_Hs01_00078092 predicted 953
4 SASI_Hs01_00078093 predicted 680
5 SASI_Hs01_00078094 predicted 1345
6 SASI_Hs01_00078095 predicted 778
7 SASI_Hs02_00302846 predicted 1270
8 SASI_Hs01_00078096 predicted 676
9 SASI_Hs01_00078097 predicted 1018
10 SASI_Hs02_00302847 predicted 530
11 SASI_Hs01_00078088 predicted 1525
12 SASI_Hs01_00078089 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035795 predicted 1449
2 SASI_Rn01_00035796 predicted 474
3 SASI_Rn01_00035797 predicted 1088
4 SASI_Rn02_00259675 predicted 1270
5 SASI_Rn01_00035798 predicted 944
6 SASI_Rn01_00035799 predicted 674
7 SASI_Rn01_00035801 predicted 1093
8 SASI_Rn01_00035803 predicted 960
9 SASI_Rn02_00259676 predicted 1123
10 SASI_Rn01_00035804 predicted 461
11 SASI_Rn01_00035800 predicted 687
12 SASI_Rn01_00035802 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194359 predicted 596
2 SASI_Mm01_00194360 predicted 837
3 SASI_Mm01_00194361 predicted 823
4 SASI_Mm01_00194362 predicted 1385
5 SASI_Mm02_00313121 predicted 1076
6 SASI_Mm01_00194363 predicted 518
7 SASI_Mm01_00194364 predicted 464
8 SASI_Mm01_00194365 predicted 1075
9 SASI_Mm01_00194366 predicted 580
10 SASI_Mm01_00194368 predicted 774
11 SASI_Mm01_00194367 predicted 1392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000583
GC MISSION shRNA Bacterial Glycerol Stock
group-specific component (vitamin D binding protein)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000583.2-1627s1c1
Sequence:CCGGGAATGATCTCTGATGACCTAACTCGAGTTAGGTCATCAGAGATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000583.2-437s1c1
Sequence:CCGGCCTGTGAAAGTAATTCTCCATCTCGAGATGGAGAATTACTTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000583.2-849s1c1
Sequence:CCGGGCTCAGCAATCTCATAAAGTTCTCGAGAACTTTATGAGATTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000583.2-850s1c1
Sequence:CCGGCTCAGCAATCTCATAAAGTTACTCGAGTAACTTTATGAGATTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000583.2-607s1c1
Sequence:CCGGCCAAAGGAATATGCTAATCAACTCGAGTTGATTAGCATATTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000583.2-1212s21c1
Sequence:CCGGGACTCATCTTCCGGAAGTATTCTCGAGAATACTTCCGGAAGATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000583.2-1312s21c1
Sequence:CCGGGCTAAGGGCCCTCTACTAAAGCTCGAGCTTTAGTAGAGGGCCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000583.2-913s21c1
Sequence:CCGGCTAGCTGAAGATATTACTAACCTCGAGGTTAGTAATATCTTCAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000583
GC MISSION shRNA shRNA Plasmid DNA
group-specific component (vitamin D binding protein)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000583.2-1627s1c1
Sequence:CCGGGAATGATCTCTGATGACCTAACTCGAGTTAGGTCATCAGAGATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000583.2-437s1c1
Sequence:CCGGCCTGTGAAAGTAATTCTCCATCTCGAGATGGAGAATTACTTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000583.2-849s1c1
Sequence:CCGGGCTCAGCAATCTCATAAAGTTCTCGAGAACTTTATGAGATTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000583.2-850s1c1
Sequence:CCGGCTCAGCAATCTCATAAAGTTACTCGAGTAACTTTATGAGATTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000583.2-607s1c1
Sequence:CCGGCCAAAGGAATATGCTAATCAACTCGAGTTGATTAGCATATTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000583.2-1212s21c1
Sequence:CCGGGACTCATCTTCCGGAAGTATTCTCGAGAATACTTCCGGAAGATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000583.2-1312s21c1
Sequence:CCGGGCTAAGGGCCCTCTACTAAAGCTCGAGCTTTAGTAGAGGGCCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000583.2-913s21c1
Sequence:CCGGCTAGCTGAAGATATTACTAACCTCGAGGTTAGTAATATCTTCAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000583
GC MISSION shRNA Lentiviral Transduction Particles
group-specific component (vitamin D binding protein)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000583.2-1627s1c1
Sequence:CCGGGAATGATCTCTGATGACCTAACTCGAGTTAGGTCATCAGAGATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000583.2-437s1c1
Sequence:CCGGCCTGTGAAAGTAATTCTCCATCTCGAGATGGAGAATTACTTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000583.2-849s1c1
Sequence:CCGGGCTCAGCAATCTCATAAAGTTCTCGAGAACTTTATGAGATTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000583.2-850s1c1
Sequence:CCGGCTCAGCAATCTCATAAAGTTACTCGAGTAACTTTATGAGATTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000583.2-607s1c1
Sequence:CCGGCCAAAGGAATATGCTAATCAACTCGAGTTGATTAGCATATTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000583.2-1212s21c1
Sequence:CCGGGACTCATCTTCCGGAAGTATTCTCGAGAATACTTCCGGAAGATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000583.2-1312s21c1
Sequence:CCGGGCTAAGGGCCCTCTACTAAAGCTCGAGCTTTAGTAGAGGGCCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000583.2-913s21c1
Sequence:CCGGCTAGCTGAAGATATTACTAACCTCGAGGTTAGTAATATCTTCAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008096
GC MISSION shRNA Bacterial Glycerol Stock
group-specific component (vitamin D binding protein)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008096.1-1004s1c1
Sequence:CCGGACCACTTCAATTGCCAGCTATCTCGAGATAGCTGGCAATTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008096.1-1116s1c1
Sequence:CCGGCCAGAAGTGTTCCTCAGCAAACTCGAGTTTGCTGAGGAACACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008096.1-1435s1c1
Sequence:CCGGGCTCACAGATTGATGCAGAAACTCGAGTTTCTGCATCAATCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008096.1-106s1c1
Sequence:CCGGGCCGAGACTATGAGAAGGATACTCGAGTATCCTTCTCATAGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008096.1-1489s1c1
Sequence:CCGGTGCACTAGCTTGGATCTTGAACTCGAGTTCAAGATCCAAGCTAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008096.1-1004s21c1
Sequence:CCGGACCACTTCAATTGCCAGCTATCTCGAGATAGCTGGCAATTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008096.1-1489s21c1
Sequence:CCGGTGCACTAGCTTGGATCTTGAACTCGAGTTCAAGATCCAAGCTAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008096.1-1116s21c1
Sequence:CCGGCCAGAAGTGTTCCTCAGCAAACTCGAGTTTGCTGAGGAACACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008096.1-106s21c1
Sequence:CCGGGCCGAGACTATGAGAAGGATACTCGAGTATCCTTCTCATAGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008096.1-1435s21c1
Sequence:CCGGGCTCACAGATTGATGCAGAAACTCGAGTTTCTGCATCAATCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008096
GC MISSION shRNA shRNA Plasmid DNA
group-specific component (vitamin D binding protein)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008096.1-1004s1c1
Sequence:CCGGACCACTTCAATTGCCAGCTATCTCGAGATAGCTGGCAATTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008096.1-1116s1c1
Sequence:CCGGCCAGAAGTGTTCCTCAGCAAACTCGAGTTTGCTGAGGAACACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008096.1-1435s1c1
Sequence:CCGGGCTCACAGATTGATGCAGAAACTCGAGTTTCTGCATCAATCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008096.1-106s1c1
Sequence:CCGGGCCGAGACTATGAGAAGGATACTCGAGTATCCTTCTCATAGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008096.1-1489s1c1
Sequence:CCGGTGCACTAGCTTGGATCTTGAACTCGAGTTCAAGATCCAAGCTAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008096.1-1004s21c1
Sequence:CCGGACCACTTCAATTGCCAGCTATCTCGAGATAGCTGGCAATTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008096.1-1489s21c1
Sequence:CCGGTGCACTAGCTTGGATCTTGAACTCGAGTTCAAGATCCAAGCTAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008096.1-1116s21c1
Sequence:CCGGCCAGAAGTGTTCCTCAGCAAACTCGAGTTTGCTGAGGAACACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008096.1-106s21c1
Sequence:CCGGGCCGAGACTATGAGAAGGATACTCGAGTATCCTTCTCATAGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008096.1-1435s21c1
Sequence:CCGGGCTCACAGATTGATGCAGAAACTCGAGTTTCTGCATCAATCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008096
GC MISSION shRNA Lentiviral Transduction Particles
group-specific component (vitamin D binding protein)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008096.1-1004s1c1
Sequence:CCGGACCACTTCAATTGCCAGCTATCTCGAGATAGCTGGCAATTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008096.1-1116s1c1
Sequence:CCGGCCAGAAGTGTTCCTCAGCAAACTCGAGTTTGCTGAGGAACACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008096.1-1435s1c1
Sequence:CCGGGCTCACAGATTGATGCAGAAACTCGAGTTTCTGCATCAATCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008096.1-106s1c1
Sequence:CCGGGCCGAGACTATGAGAAGGATACTCGAGTATCCTTCTCATAGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008096.1-1489s1c1
Sequence:CCGGTGCACTAGCTTGGATCTTGAACTCGAGTTCAAGATCCAAGCTAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008096.1-1004s21c1
Sequence:CCGGACCACTTCAATTGCCAGCTATCTCGAGATAGCTGGCAATTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008096.1-1489s21c1
Sequence:CCGGTGCACTAGCTTGGATCTTGAACTCGAGTTCAAGATCCAAGCTAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008096.1-1116s21c1
Sequence:CCGGCCAGAAGTGTTCCTCAGCAAACTCGAGTTTGCTGAGGAACACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008096.1-106s21c1
Sequence:CCGGGCCGAGACTATGAGAAGGATACTCGAGTATCCTTCTCATAGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008096.1-1435s21c1
Sequence:CCGGGCTCACAGATTGATGCAGAAACTCGAGTTTCTGCATCAATCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks