EMAIL THIS PAGE TO A FRIEND

GCA

grancalcin, EF-hand calcium binding protein

55 Gene Product Result for
Synonyms: GCL
UniProtKB ID: P28676, B2R5X3, Q53TB5, Q59EP3
Gene ID:
Human(25801) Summary: This gene product, grancalcin, is a calcium-binding protein abundant in neutrophils and macrophages. It belongs to the penta-EF-hand subfamily of proteins which includes sorcin, calpain, and ALG-2. Grancalcin localization is dependent upon calcium and magnesium. In the absence of divalent cation, grancalcin localizes to the cytosolic fraction; with magnesium alone, it partitions with the granule fraction; and in the presence of magnesium and calcium, it associates with both the granule and membrane fractions, suggesting a role for grancalcin in granule-membrane fusion and degranulation. [provided by RefSeq, Jul 2008]
Mouse(227960) grancalcin
Rat(295647) grancalcin
domestic cat(101098073) grancalcin, EF-hand calcium binding protein
cow(507139) grancalcin, EF-hand calcium binding protein
dog(608208) grancalcin, EF-hand calcium binding protein
naked mole-rat(101720587) grancalcin, EF-hand calcium binding protein
domestic guinea pig(100717324) grancalcin, EF-hand calcium binding protein
sheep(101105979) grancalcin, EF-hand calcium binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012198 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012198 Rosetta Predictions human pricing
NM_001106483 Rosetta Predictions rat pricing
NM_145523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055422 predicted 753
2 SASI_Hs01_00055423 predicted 196
3 SASI_Hs01_00055424 predicted 448
4 SASI_Hs01_00055425 predicted 708
5 SASI_Hs02_00343849 predicted 715
6 SASI_Hs01_00055426 predicted 197
7 SASI_Hs01_00055427 predicted 360
8 SASI_Hs01_00055428 predicted 814
9 SASI_Hs01_00055429 predicted 646
10 SASI_Hs01_00055430 predicted 744
11 SASI_Hs01_00055431 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219408 predicted 940
2 SASI_Rn02_00219409 predicted 959
3 SASI_Rn02_00219410 predicted 1086
4 SASI_Rn02_00219411 predicted 1004
5 SASI_Rn02_00219412 predicted 421
6 SASI_Rn02_00219413 predicted 424
7 SASI_Rn02_00219414 predicted 555
8 SASI_Rn02_00219415 predicted 702
9 SASI_Rn02_00219416 predicted 529
10 SASI_Rn02_00219417 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124637 predicted 554
2 SASI_Mm02_00340997 predicted 1048
3 SASI_Mm01_00124638 predicted 1000
4 SASI_Mm01_00124639 predicted 972
5 SASI_Mm01_00124640 predicted 495
6 SASI_Mm01_00124641 predicted 713
7 SASI_Mm01_00124642 predicted 978
8 SASI_Mm01_00124643 predicted 394
9 SASI_Mm01_00124644 predicted 412
10 SASI_Mm01_00124645 predicted 675
11 SASI_Mm01_00124646 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012198
VALIDATED
GCA MISSION shRNA Bacterial Glycerol Stock
grancalcin, EF-hand calcium binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_012198.3-732s21c1
Sequence:CCGGCGAGCATTGACAGATTTCTTTCTCGAGAAAGAAATCTGTCAATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012198.3-413s21c1
Sequence:CCGGGTCTGGAATTAATGGAACTTACTCGAGTAAGTTCCATTAATTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012198.3-296s21c1
Sequence:CCGGGCCAGCATATTCAGACACTTACTCGAGTAAGTGTCTGAATATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012198.3-783s21c1
Sequence:CCGGGCGAATTTCATATATGACGATCTCGAGATCGTCATATATGAAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012198.3-616s21c1
Sequence:CCGGCCATTGGTCTTATGGGTTATACTCGAGTATAACCCATAAGACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012198.2-229s1c1
Sequence:CCGGGCCAGCATATTCAGACACTTACTCGAGTAAGTGTCTGAATATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012198.2-716s1c1
Sequence:CCGGGCGAATTTCATATATGACGATCTCGAGATCGTCATATATGAAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012198.2-346s1c1
Sequence:CCGGGTCTGGAATTAATGGAACTTACTCGAGTAAGTTCCATTAATTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012198.2-665s1c1
Sequence:CCGGCGAGCATTGACAGATTTCTTTCTCGAGAAAGAAATCTGTCAATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012198.2-549s1c1
Sequence:CCGGCCATTGGTCTTATGGGTTATACTCGAGTATAACCCATAAGACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012198
VALIDATED
GCA MISSION shRNA shRNA Plasmid DNA
grancalcin, EF-hand calcium binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_012198.3-732s21c1
Sequence:CCGGCGAGCATTGACAGATTTCTTTCTCGAGAAAGAAATCTGTCAATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012198.3-413s21c1
Sequence:CCGGGTCTGGAATTAATGGAACTTACTCGAGTAAGTTCCATTAATTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012198.3-296s21c1
Sequence:CCGGGCCAGCATATTCAGACACTTACTCGAGTAAGTGTCTGAATATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012198.3-783s21c1
Sequence:CCGGGCGAATTTCATATATGACGATCTCGAGATCGTCATATATGAAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012198.3-616s21c1
Sequence:CCGGCCATTGGTCTTATGGGTTATACTCGAGTATAACCCATAAGACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012198.2-229s1c1
Sequence:CCGGGCCAGCATATTCAGACACTTACTCGAGTAAGTGTCTGAATATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012198.2-716s1c1
Sequence:CCGGGCGAATTTCATATATGACGATCTCGAGATCGTCATATATGAAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012198.2-346s1c1
Sequence:CCGGGTCTGGAATTAATGGAACTTACTCGAGTAAGTTCCATTAATTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012198.2-665s1c1
Sequence:CCGGCGAGCATTGACAGATTTCTTTCTCGAGAAAGAAATCTGTCAATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012198.2-549s1c1
Sequence:CCGGCCATTGGTCTTATGGGTTATACTCGAGTATAACCCATAAGACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012198
VALIDATED
GCA MISSION shRNA Lentiviral Transduction Particles
grancalcin, EF-hand calcium binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_012198.3-732s21c1
Sequence:CCGGCGAGCATTGACAGATTTCTTTCTCGAGAAAGAAATCTGTCAATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012198.3-413s21c1
Sequence:CCGGGTCTGGAATTAATGGAACTTACTCGAGTAAGTTCCATTAATTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012198.3-296s21c1
Sequence:CCGGGCCAGCATATTCAGACACTTACTCGAGTAAGTGTCTGAATATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012198.3-783s21c1
Sequence:CCGGGCGAATTTCATATATGACGATCTCGAGATCGTCATATATGAAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012198.3-616s21c1
Sequence:CCGGCCATTGGTCTTATGGGTTATACTCGAGTATAACCCATAAGACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012198.2-229s1c1
Sequence:CCGGGCCAGCATATTCAGACACTTACTCGAGTAAGTGTCTGAATATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012198.2-716s1c1
Sequence:CCGGGCGAATTTCATATATGACGATCTCGAGATCGTCATATATGAAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012198.2-346s1c1
Sequence:CCGGGTCTGGAATTAATGGAACTTACTCGAGTAAGTTCCATTAATTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012198.2-665s1c1
Sequence:CCGGCGAGCATTGACAGATTTCTTTCTCGAGAAAGAAATCTGTCAATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012198.2-549s1c1
Sequence:CCGGCCATTGGTCTTATGGGTTATACTCGAGTATAACCCATAAGACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145523
VALIDATED
GCA MISSION shRNA Bacterial Glycerol Stock
grancalcin, EF-hand calcium binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145523.3-547s21c1
Sequence:CCGGGAGTCAAGCCATCGCTCTTATCTCGAGATAAGAGCGATGGCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145523.3-672s21c1
Sequence:CCGGGCGCCCTGACAGATTTCTTTACTCGAGTAAAGAAATCTGTCAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145523.3-746s21c1
Sequence:CCGGTTGCAGGGCACTATGACAATTCTCGAGAATTGTCATAGTGCCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145523.3-1143s21c1
Sequence:CCGGTATCTAAAGGCTACAAGTTATCTCGAGATAACTTGTAGCCTTTAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145523.3-615s21c1
Sequence:CCGGACAGCAAGAATGGCCGGATTTCTCGAGAAATCCGGCCATTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145523.2-1518s1c1
Sequence:CCGGCCCTCATTGTTTGTAGAAATTCTCGAGAATTTCTACAAACAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145523.2-673s1c1
Sequence:CCGGGCGCCCTGACAGATTTCTTTACTCGAGTAAAGAAATCTGTCAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145523.2-267s1c1
Sequence:CCGGGACGACTCCATGTGGACTTATCTCGAGATAAGTCCACATGGAGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145523.2-353s1c1
Sequence:CCGGGTCTGGAATTAGTGGAACTTACTCGAGTAAGTTCCACTAATTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145523.2-269s1c1
Sequence:CCGGCGACTCCATGTGGACTTATTTCTCGAGAAATAAGTCCACATGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145523
VALIDATED
GCA MISSION shRNA shRNA Plasmid DNA
grancalcin, EF-hand calcium binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145523.3-547s21c1
Sequence:CCGGGAGTCAAGCCATCGCTCTTATCTCGAGATAAGAGCGATGGCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145523.3-672s21c1
Sequence:CCGGGCGCCCTGACAGATTTCTTTACTCGAGTAAAGAAATCTGTCAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145523.3-746s21c1
Sequence:CCGGTTGCAGGGCACTATGACAATTCTCGAGAATTGTCATAGTGCCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145523.3-1143s21c1
Sequence:CCGGTATCTAAAGGCTACAAGTTATCTCGAGATAACTTGTAGCCTTTAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145523.3-615s21c1
Sequence:CCGGACAGCAAGAATGGCCGGATTTCTCGAGAAATCCGGCCATTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145523.2-1518s1c1
Sequence:CCGGCCCTCATTGTTTGTAGAAATTCTCGAGAATTTCTACAAACAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145523.2-673s1c1
Sequence:CCGGGCGCCCTGACAGATTTCTTTACTCGAGTAAAGAAATCTGTCAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145523.2-267s1c1
Sequence:CCGGGACGACTCCATGTGGACTTATCTCGAGATAAGTCCACATGGAGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145523.2-353s1c1
Sequence:CCGGGTCTGGAATTAGTGGAACTTACTCGAGTAAGTTCCACTAATTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145523.2-269s1c1
Sequence:CCGGCGACTCCATGTGGACTTATTTCTCGAGAAATAAGTCCACATGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145523
VALIDATED
GCA MISSION shRNA Lentiviral Transduction Particles
grancalcin, EF-hand calcium binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145523.3-547s21c1
Sequence:CCGGGAGTCAAGCCATCGCTCTTATCTCGAGATAAGAGCGATGGCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145523.3-672s21c1
Sequence:CCGGGCGCCCTGACAGATTTCTTTACTCGAGTAAAGAAATCTGTCAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145523.3-746s21c1
Sequence:CCGGTTGCAGGGCACTATGACAATTCTCGAGAATTGTCATAGTGCCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145523.3-1143s21c1
Sequence:CCGGTATCTAAAGGCTACAAGTTATCTCGAGATAACTTGTAGCCTTTAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145523.3-615s21c1
Sequence:CCGGACAGCAAGAATGGCCGGATTTCTCGAGAAATCCGGCCATTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145523.2-1518s1c1
Sequence:CCGGCCCTCATTGTTTGTAGAAATTCTCGAGAATTTCTACAAACAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145523.2-673s1c1
Sequence:CCGGGCGCCCTGACAGATTTCTTTACTCGAGTAAAGAAATCTGTCAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145523.2-267s1c1
Sequence:CCGGGACGACTCCATGTGGACTTATCTCGAGATAAGTCCACATGGAGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145523.2-353s1c1
Sequence:CCGGGTCTGGAATTAGTGGAACTTACTCGAGTAAGTTCCACTAATTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145523.2-269s1c1
Sequence:CCGGCGACTCCATGTGGACTTATTTCTCGAGAAATAAGTCCACATGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks